Fasl (NM_001205243) Mouse Untagged Clone

CAT#: MC225813

Fasl (untagged) - Mouse Fas ligand (TNF superfamily, member 6) (Fasl), transcript variant 2



  "NM_001205243" in other vectors (1)

CN¥ 1,200.00

CN¥ 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms APT1LG1; CD95-L; CD95L; CD178; Fas-L; Faslg; gld; Tnfsf6; Tnlg1a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225813 representing NM_001205243
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCAGCAGCCCATGAATTACCCATGTCCCCAGATCTTCTGGGTAGACAGCAGTGCCACTTCATCTTGGG
CTCCTCCAGGGTCAGTTTTTCCCTGTCCATCTTGTGGGCCTAGAGGGCCGGACCAAAGGAGACCGCCACC
TCCACCACCACCTGTGTCACCACTACCACCGCCATCACAACCACTCCCACTGCCGCCACTGACCCCTCTA
AAGAAGAAGGACCACAACACAAATCTGTGGCTACCGGTGGTATTTTTCATGGTTCTGGTGGCTCTGGTTG
GAATGGGATTAGGAATGTATCAGCTCTTCCACCTGCAGAAGGAACTGGCAGAACTCCGTGAGCCAACCCC
AGTACACCCTCTGAAAAAAAAGAGCCGAGGAGTGTGGCCCATTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001205243
Insert Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001205243.1, NP_001192172.1
RefSeq Size 1889 bp
RefSeq ORF 396 bp
Locus ID 14103
Gene Summary Cytokine that binds to TNFRSF6/FAS, a receptor that transduces the apoptotic signal into cells (PubMed:7511063). Involved in cytotoxic T-cell-mediated apoptosis, natural killer cell-mediated apoptosis and in T-cell development (PubMed:19794494, PubMed:7532682). Initiates fratricidal/suicidal activation-induced cell death (AICD) in antigen-activated T-cells contributing to the termination of immune responses (PubMed:19794494). TNFRSF6/FAS-mediated apoptosis has also a role in the induction of peripheral tolerance (PubMed:10779162). Binds to TNFRSF6B/DcR3, a decoy receptor that blocks apoptosis (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an exon in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...