Oaz1 (NM_001301034) Mouse Untagged Clone

CAT#: MC225809

Oaz1 (untagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1), transcript variant 2



  "NM_001301034" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
OAZ1 Antibody - middle region
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Antiz; Antizyme; AZ; AZ-; AZ-1; AZ1; Oaz; ODC-Az
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225809 representing NM_001301034
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTGAAATCCTCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAAC
GCAGCGCCACGCTTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAG
CGAGAGGGTTGCCCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCCATGGTGAAATCC
TCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAACGCAGCGCCACGC
TTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAGCGAGAGGGTTGC
CCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCC


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301034
Insert Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001301034.1, NP_001287963.1
RefSeq Size 1086 bp
RefSeq ORF 679 bp
Locus ID 18245
Gene Summary The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 1, the first member of the antizyme family, that has broad tissue distribution, and negatively regulates intracellular polyamine levels by binding to and targeting ODC for degradation, as well as inhibiting polyamine uptake. Antizyme 1 mRNA contains two potential in-frame AUGs; and studies in rat suggest that alternative use of the two translation initiation sites results in N-terminally distinct protein isoforms with different subcellular localization. Alternatively spliced transcript variants have also been noted for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (2) uses an alternate, in-frame acceptor splice site at the second exon compared to variant 1. The resulting isoform (2) lacks 2 internal amino acids compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...