Lin7a (NM_001284329) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	AI848705; LIN-7A; MALS-1; TIP-33; Veli; Veli1
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225687 representing NM_001284329 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGAGGGAAGGAACAGAATTCCCCGATTTACATCTCCCGCATCATCCCTGGAGGGGTGGCTGAAAGAC ATGGAGGCCTCAAAAGAGGGGACCAGCTGCTATCAGTGAACGGAGTGAGTGTGGAAGGGGAGCACCATGA GAAAGCTGTGGAACTTCTCAAGGCTGCTAAGGACAGTGTGAAGCTGGTGGTCAGATACACCCCAAAAGTC CTGGAAGAGATGGAGGCTCGTTTCGAGAAGCTGCGGACAGCTCGGCGTCGACAGCAGCAGCAGTTGCTCA TTCAGCAGCAGCAACAGCAGCAGCAACAACAACCACAACAAAACCACATGTCATAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites	SgfI-MluI
ACCN	NM_001284329
Insert Size	336 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001284329.1, NP_001271258.1
RefSeq Size	6604 bp
RefSeq ORF	336 bp
Locus ID	108030
Gene Summary	Plays a role in establishing and maintaining the asymmetric distribution of channels and receptors at the plasma membrane of polarized cells. Forms membrane-associated multiprotein complexes that may regulate delivery and recycling of proteins to the correct membrane domains. The tripartite complex composed of LIN7 (LIN7A, LIN7B or LIN7C), CASK and APBA1 may have the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Ensures the proper localization of GRIN2B (subunit 2B of the NMDA receptor) to neuronal postsynaptic density and may function in localizing synaptic vesicles at synapses where it is recruited by beta-catenin and cadherin. Required to localize Kir2 channels, GABA transporter (SLC6A12) and EGFR/ERBB1, ERBB2, ERBB3 and ERBB4 to the basolateral membrane of epithelial cells.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) has multiple differences, compared to variant 1. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.