Sh3kbp1 (NM_001290664) Mouse Untagged Clone

Specifications

Product Data
Type	Mouse Untagged Clone
Tag	Tag Free
Synonyms	1200007H22Rik; 1700125L08Rik; 5830464D22Rik; AI447724; Cin85; IN85; Ruk; Seta
Vector	pCMV6-Entry
E. coli Selection	Kanamycin (25 ug/mL)
Mammalian Cell Selection	Neomycin
Sequence Data	Fully Sequenced ORF (showhide) >MC225684 representing NM_001290664 Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCTGCCAGCAGTGGGCCAGCTTCTCTCTCTTCAGTGGCATCCTCACCCATGTCATCCTCTTTGG GAACAGCTGGACAGAGAGCCAGTTCTCCATCTCTGTTCAGCACAGAAGGAAAGCCAAAGATGGAGCCAGC AGTGAGCAGCCAGGCTGCTATCGAGGAGCTTAAGATGCAAGTCCGTGAGCTGAGGACCATCATTGAGACC ATGAAGGACCAGCAGAAACGTGAGATTAAGCAGTTACTGTCAGAATTGGATGAAGAGAAAAAGATCCGGC TCCGGTTGCAGATGGAAGTGAACGACATAAAGAAAGCTCTTCAATCAAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA
Chromatograms	CHROMATOGRAMS Sequencher program is needed, download here.
Restriction Sites	SgfI-MluI
ACCN	NM_001290664
Insert Size	333 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation	Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001290664.1, NP_001277593.1
RefSeq Size	3721 bp
RefSeq ORF	333 bp
Locus ID	58194
UniProt ID	Q8R550
Gene Summary	Adapter protein involved in regulating diverse signal transduction pathways. Involved in the regulation of endocytosis and lysosomal degradation of ligand-induced receptor tyrosine kinases, including EGFR and MET/hepatocyte growth factor receptor, through an association with CBL and endophilins. The association with CBL, and thus the receptor internalization, may be inhibited by an interaction with PDCD6IP and/or SPRY2. Involved in regulation of ligand-dependent endocytosis of the IgE receptor. Attenuates phosphatidylinositol 3-kinase activity by interaction with its regulatory subunit. May be involved in regulation of cell adhesion; promotes the interaction between TTK2B and PDCD6IP. May be involved in the regulation of cellular stress response via the MAPK pathways through its interaction with MAP3K4. Is involved in modulation of tumor necrosis factor mediated apoptosis. Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the control of cell shape and migration (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (5, also known as Rukh4) lacks multiple coding exons and contains an alternate 5' exon, compared to variant 1. It initiates translation at a downstream in-frame start codon. The encoded isoform (4) has a shorter N-terminus than isoform 1. Variants 4 and 5 encode the same isoform (4).

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.