Hikeshi (NM_001291288) Mouse Untagged Clone

CAT#: MC225614

l7Rn6 (untagged) - Mouse lethal, Chr 7, Rinchik 6 (l7Rn6), transcript variant 4



  "NM_001291288" in other vectors (1)

CN¥ 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610007P06Rik; 1110002N09Rik; l(7)6Rn; l7Rn6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225614 representing NM_001291288
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATATTGTGCGAACCCCATCTGTTGCCCAGATTGGCATCTCGGTGGAATTGTTGGACAGTCTGGCTC
AGCAGACTCCTGTAGGCAGTGCTGCCGTGTCCTCCGTTGACTCCTTTACGCAGTTCACACAGAAGATGTT
GGACAACTTCTACAATTTTGCTTCATCATTTGCTCTCTCTCAGGCCCAGATGACACCAAATCCATCAGAA
ATGTTCATCCCAGCAAATGTGGTTCTGAAATGGTATGAAAACTTTCAAAGACGACTAGCACAGAACCCCC
TCTTTTGGAAAACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001291288
Insert Size 297 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291288.1, NP_001278217.1
RefSeq Size 1226 bp
RefSeq ORF 297 bp
Locus ID 67669
Gene Summary Acts as a specific nuclear import carrier for HSP70 proteins following heat-shock stress: acts by mediating the nucleoporin-dependent translocation of ATP-bound HSP70 proteins into the nucleus. HSP70 proteins import is required to protect cells from heat shock damages. Does not translocate ADP-bound HSP70 proteins into the nucleus (By similarity). May also be indirectly required for organization and/or function of the secretory apparatus in Clara cells in lung.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) contains an alternate exon and initiates translation at an alternate start codon compared to variant 1. The resulting isoform (d) is shorter at the N-terminus compared to isoform a. Variants 4 and 5 both encode the same isoform (d).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...