Cox6b2 (NM_001289848) Mouse Untagged Clone

CAT#: MC225569

Cox6b2 (untagged) - Mouse cytochrome c oxidase subunit VIb polypeptide 2 (Cox6b2), transcript variant 3



  "NM_001289848" in other vectors (1)

CN¥ 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700067P11Rik; BC048670; COXVIB2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225569 representing NM_001289848
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGGGTGTTCAAGCCCAGAAGCCCCCTCCGGGCCAATGGACAACGCCGCCCTTTGATCCGCGCTTCC
CTAACCAGAACCAGACGCGTAACTGCTACCAGAATTTTCTGGACTACCACCGGTGTGTGAAGACCATGAA
TCGCCGCGGAAAGAGCACACAACCCTGCGAGTACTATTTCCGTGTATTCCATTCACTGTGTCCCATCAGC
TGGGTGCAGCGCTGGAATGAGCAGATCAAGCAGGGAACTTTCCCGGGCAAAATATGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001289848
Insert Size 267 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289848.1, NP_001276777.1
RefSeq Size 599 bp
RefSeq ORF 267 bp
Locus ID 333182
UniProt ID Q80ZN9
Gene Summary This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. This protein may be one of the heme-binding subunits of the oxidase (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (1). Variants 1 through 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...