Unc5c (NM_009472) Mouse Untagged Clone
CAT#: MC222686
Unc5c (untagged) - Mouse unc-5 homolog C (C. elegans) (Unc5c), (10ug)
CN¥ 10,240.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | B130051O18Rik; rcm; Unc5h3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC222686 representing NM_009472
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_009472 |
Insert Size | 2796 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_009472.3, NP_033498.1 |
RefSeq Size | 9296 bp |
RefSeq ORF | 2796 bp |
Locus ID | 22253 |
UniProt ID | O08747 |
Gene Summary | Receptor for netrin required for axon guidance (PubMed:22685302, PubMed:10399920). Mediates axon repulsion of neuronal growth cones in the developing nervous system upon ligand binding (PubMed:10399920, PubMed:22685302). NTN1/Netrin-1 binding might cause dissociation of UNC5C from polymerized TUBB3 in microtubules and thereby lead to increased microtubule dynamics and axon repulsion (PubMed:28483977). Axon repulsion in growth cones may also be caused by its association with DCC that may trigger signaling for repulsion (PubMed:10399920). Might also collaborate with DSCAM in NTN1-mediated axon repulsion independently of DCC (PubMed:22685302). Also involved in corticospinal tract axon guidance independently of DCC (PubMed:9126743, PubMed:9389662, PubMed:12451134). Involved in dorsal root ganglion axon projection towards the spinal cord (By similarity). It also acts as a dependence receptor required for apoptosis induction when not associated with netrin ligand (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region compared to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227393 | Unc5c (tGFP-tagged) - Mouse unc-5 homolog C (C. elegans) (Unc5c), (10ug) |
CN¥ 11,824.00 |
|
MR227393 | Unc5c (Myc-DDK-tagged) - Mouse unc-5 homolog C (C. elegans) (Unc5c) |
CN¥ 10,224.00 |
|
MR227393L3 | Lenti ORF clone of Unc5c (Myc-DDK-tagged) - Mouse unc-5 homolog C (C. elegans) (Unc5c) |
CN¥ 11,210.00 |
|
MR227393L4 | Lenti ORF clone of Unc5c (mGFP-tagged) - Mouse unc-5 homolog C (C. elegans) (Unc5c) |
CN¥ 11,210.00 |