United States
Germany
Japan
United Kingdom
China
Lrp8 (NM_001080926) Mouse Untagged Clone
CAT＃: MC222314
Lrp8 (untagged) - Mouse low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (Lrp8), transcript variant 2, (10ug)
CNY 9,568.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4932703M08Rik; AA921429; AI848122; ApoER2; Lr8b |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC222314 representing NM_001080926
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001080926 |
| Insert Size | 2613 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001080926.1, NP_001074395.1 |
| RefSeq Size | 7296 bp |
| RefSeq ORF | 2613 bp |
| Locus ID | 16975 |
| Gene Summary | Cell surface receptor for Reelin (RELN) and apolipoprotein E (apoE)-containing ligands. LRP8 participates in transmitting the extracellular Reelin signal to intracellular signaling processes, by binding to DAB1 on its cytoplasmic tail. Reelin acts via both the VLDL receptor (VLDLR) and LRP8 to regulate DAB1 tyrosine phosphorylation and microtubule function in neurons. LRP8 has higher affinity for Reelin than VLDLR. LRP8 is thus a key component of the Reelin pathway which governs neuronal layering of the forebrain during embryonic brain development. Binds the endoplasmic reticulum resident receptor-associated protein (RAP). Binds dimers of beta 2-glycoprotein I and may be involved in the suppression of platelet aggregation in the vasculature. Highly expressed in the initial segment of the epididymis, where it affects the functional expression of clusterin and phospholipid hydroperoxide glutathione peroxidase (PHGPx), two proteins required for sperm maturation (PubMed:12695510). May also function as an endocytic receptor. Not required for endocytic uptake of SEPP1 in the kidney which is mediated by LRP2 (PubMed:18174160). Together with its ligand, apolipoprotein E (apoE), may indirectly play a role in the suppression of the innate immune response by controlling the survival of myeloid-derived suppressor cells (PubMed:29336888).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) encodes isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226275 | Lrp8 (tGFP-tagged) - Mouse low density lipoprotein receptor-related protein 8 apolipoprotein e receptor (Lrp8) transcript variant 2, (10ug) |
CNY 11,160.00 |
|
| MR226275 | Lrp8 (Myc-DDK-tagged) - Mouse low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (Lrp8), transcript variant 2 |
CNY 9,560.00 |
|
| MR226275L3 | Lenti ORF clone of Lrp8 (Myc-DDK-tagged) - Mouse low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (Lrp8), transcript variant 2 |
CNY 10,550.00 |
|
| MR226275L4 | Lenti ORF clone of Lrp8 (mGFP-tagged) - Mouse low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (Lrp8), transcript variant 2 |
CNY 11,960.00 |
