Dab2 (NM_001037905) Mouse Untagged Clone

CAT#: MC218757

Dab2 (untagged) - Mouse disabled homolog 2 (Drosophila) (Dab2), transcript variant 3, (10ug)



  "NM_001037905" in other vectors (1)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5730435J12Rik; AA960054; AI957090; D15Wsu122e; D630005B22Rik; Doc-2; Doc2; p96
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218757 representing NM_001037905
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTAACGAAGTAGAAACAAGCACAACCAATGGCCAGCCTGACCAACAGGCTGCCCCGAAAGCGCCAT
CAAAGAAGGAGAAGAAGAAAGGTTCTGAAAAGACAGACGAGTACTTGTTGGCCAGGTTCAAAGGTGATGG
TGTAAAATACAAGGCCAAGCTAATCGGTATTGATGATGTGCCTGATGCTCGAGGAGACAAAATGAGTCAG
GATTCTATGATGAAACTCAAGGGAATGGCAGCAGCTGGTCGCTCTCAGGGACAACACAAGCAAAGAATCT
GGGTCAACATTTCCTTGTCTGGCATAAAAATCATTGATGAGAAAACTGGGGTAATTGAACATGAACATCC
AGTAAATAAGATTTCCTTCATTGCTCGTGATGTGACAGACAACAGAGCATTTGGTTATGTGTGTGGAGGT
GAAGGCCAGCATCAATTTTTTGCTATAAAAACAGGGCAACAGGCTGAACCATTAGTCGTCGATCTTAAAG
ACCTTTTTCAAGTTATCTATAATGTAAAGAAAAAGGAAGAAGATAAGAAAAAGGTTGAAGAAGCCAACAA
AGCAGAAGAGAATGGAAGTGAGGCCCTAATGACCCTTGATGATCAAGCTAACAAATTGAAGCTGGGTGTT
GACCAGATGGATTTGTTTGGGGACATGTCTACACCTCCTGACCTAAATAGTCCAACATCTTCAGCAAACG
ACTTGCTTGCTTCAGACATCTTTGCCTCAGAACCTCCAGGCCAGATGTCCCCCACAGGACAACCTGCAGT
CCCGCAGTCGAACTTTCTGGATCTCTTCAAAGGCAATGCTCCTGCCCCAGTGGGGCCCCTTGTAGGTCTA
GGTACGGTCCCAGTAACACCCCCCCAAGCAGGACCCTGGACGCCTGTTGTCTACAGTCCTTCGACAACTG
TGGTCCCAGGAGCCATAATAAGTGGCCAGCCTCCCAGTTTTGGCCAGCCACTCGTTTTTGGTACAACCCC
AGCAGTACAAGTCTGGAATCAGTCTCCATCATTTGCAACCCCAGCTTCCCCTCCACCCCCCACAGTTTGG
TGTCCTACCACATCTGTGGCGCCCAACGCTTGGTCATCCACAAGCCCTCTGGGGAATCCTTTTCAGAGTA
ATAATATCTTTCCACCTCCCACCATGTCCACTCAGTCCTCTCCTCAGCCTATGATGTCCTCTGTTCTGGC
CACACCGCCTCAACCACCTCCCCGAAATGGCCCACTAAAGGACATTCCCAGTGACGCTTTCACTGGCTTA
GACCCCCTTGGGGATAAAGAGGTCAAGGAAGTGAAAGAAATGTTTAAGGACTTCCAGCTGCGGCAGCCAC
CTCTTGTTCCCTCAAGGAAGGGGGAGACGCCTCCCTCTGGGACTTCAAGCGCCTTCTCCAGTTACTTCAA
CAATAAAGTTGGCATTCCTCAGGAGCATGTAGACCATGATGATTTTGATGCCAATCAACTGTTGAACAAG
ATTAATGAACCACCAAAGCCAGCCCCGAGACAAGGTGTCCTCTTGGGTACCAAGTCTGCTGACAATTCAC
TCGAGAACCCTTTCTCCAAAGGGTTCAGCTCATCAAACCCCTCTGTGGTTTCTCAGCCTGCATCTTCTGA
TCCCCACAGGAGCCCTTTCGGAAATCCTTTTGCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001037905
Insert Size 1647 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001037905.3, NP_001032994.1
RefSeq Size 3866 bp
RefSeq ORF 1647 bp
Locus ID 13132
UniProt ID P98078
Gene Summary Adapter protein that functions as clathrin-associated sorting protein (CLASP) required for clathrin-mediated endocytosis of selected cargo proteins. Can bind and assemble clathrin, and binds simultaneously to phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) and cargos containing non-phosphorylated NPXY internalization motifs, such as the LDL receptor, to recruit them to clathrin-coated pits. Can function in clathrin-mediated endocytosis independently of the AP-2 complex. Involved in endocytosis of integrin beta-1; this function seems to redundant with the AP-2 complex and seems to require DAB2 binding to endocytosis accessory EH domain-containing proteins such as EPS15, EPS15L1 and ITSN1. Involved in endocytosis of cystic fibrosis transmembrane conductance regulator/CFTR. Isoform p96 is involved in endocytosis of megalin/LRP2 lipoprotein receptor during embryonal development. Required for recycling of the TGF-beta receptor. Isoform p67 is not involved in LDL receptor endocytosis. Involved in CFTR trafficking to the late endosome. Involved in several receptor-mediated signaling pathways. Involved in TGF-beta receptor signaling and facilitates phosphorylation of the signal transducer SMAD2. Mediates TFG-beta-stimulated JNK activation. May inhibit the canoniocal Wnt/beta-catenin signaling pathway by stabilizing the beta-catenin destruction complex through a competing association with axin preventing its dephosphorylation through protein phosphatase 1 (PP1). Sequesters LRP6 towards clathrin-mediated endocytosis, leading to inhibition of Wnt/beta-catenin signaling. May activate non-canonical Wnt signaling. In cell surface growth factor/Ras signaling pathways proposed to inhibit ERK activation by interrupting the binding of GRB2 to SOS1 and to inhibit SRC by preventing its activating phosphorylation at 'Tyr-419'. Proposed to be involved in modulation of androgen receptor (AR) signaling mediated by SRC activation; seems to compete with AR for interaction with SRC. Plays a role in the CSF-1 signal transduction pathway. Plays a role in cellular differentiation. Involved in cell positioning and formation of visceral endoderm (VE) during embryogenesis and proposed to be required in the VE to respond to Nodal signaling coming from the epiblast. Required for the epithelial to mesenchymal transition, a process necessary for proper embryonic development. May be involved in myeloid cell differentiation and can induce macrophage adhesion and spreading. Isoform p67 may be involved in transcriptional regulation. May act as a tumor suppressor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 2 and 3 both encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...