Naa40 (NM_027643) Mouse Untagged Clone

CAT#: MC218422

Naa40 (untagged) - Mouse N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae) (Naa40), (10ug)



  "NM_027643" in other vectors (3)

CNY 6,940.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Naa40 Antibody - C-terminal region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4931433E08Rik; AU023197; Nat11; NatD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218422 representing NM_027643
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGAGAAAGTCGAGCAAAGCCAAAGAGAAGAAGCAGAAACGATTGGAGGAGAGAGCGGCCATGGATG
CTGTGTGTGCCAAAGTGGATGCTGCCAACAGGCTTGGAGACCCTCTGGAGGCATTCCCAGTCTTCAAGAA
GTATGACCGCAATGGGTTGAATGTCTCCATTGAATGTAAGCGAGTGTCTGGATTGGAGCCAGCCACTGTG
GACTGGGCCTTCGACCTGACCAAAACCAATATGCAGACGATGTATGAGCAAAGTGAGTGGGGCTGGAAGG
ACCGAGAAAAACGGGAGGAAATGACCGATGACCGAGCCTGGTACCTCATTGCTTGGGAAAACAGTTCCAT
CCCAGTTGCCTTTTCTCACTTCCGGTTTGATGTGGAGTGCGGGGATGAAGTCCTGTACTGCTATGAAGTG
CAGCTGGAAAGCAAGGTACGGCGGAAAGGCCTAGGGAAGTTCCTCATTCAGATCCTGCAGCTCATGGCCA
ACAGCACACAGATGAAGAAGGTGATGTTAACTGTTTTTAAACATAATCATGGCGCCTATCAGTTCTTCCG
AGAGGCACTGCAGTTTGAAATTGATGACTCTTCACCCAGCATGTCTGGTTGCTGTGGGGAGGACTGTTCC
TATGAGATTCTGAGCCGGAGGACCAAGTTCGGGGACAGTCAGCACTCCCACACAGGCGGCCACTGTGGTG
GCTGTTGCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_027643
Insert Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_027643.1, NP_081919.1
RefSeq Size 3275 bp
RefSeq ORF 714 bp
Locus ID 70999
UniProt ID Q8VE10
Gene Summary N-alpha-acetyltransferase that specifically mediates the acetylation of the N-terminal residues of histones H4 and H2A (By similarity). In contrast to other N-alpha-acetyltransferase, has a very specific selectivity for histones H4 and H2A N-terminus and specifically recognizes the 'Ser-Gly-Arg-Gly sequence' (By similarity). Acts as a negative regulator of apoptosis (By similarity). May play a role in hepatic lipid metabolism (PubMed:22231784).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...