Rab26 (NM_177375) Mouse Untagged Clone

CAT#: MC218056

Rab26 (untagged) - Mouse RAB26, member RAS oncogene family (Rab26), (10ug)



  "NM_177375" in other vectors (3)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A830020M03Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218056 representing NM_177375
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCAGGAAGAAGACCCCCAAGAGCAAGGGGGGGAGTGAGCCGGCTACCTCTACGCTGCCCGCCGCCG
CCGCCGCCACCAATGGGCCACGTCTGGCACATCCGAGGACTGTGCGCCCTGGCCCAGAGGCACCGCCCAA
TGGGCCCCCGCAGTCCATCCGGCCCTCACTTGGTAGCACTGGAGACTTCTACGATGTTGCTTTCAAGGTC
ATGCTGGTGGGGGATTCCGGTGTGGGGAAGACCTGCCTGCTTGTGCGCTTCAAGGATGGGGCTTTCCTGG
CTGGTACCTTCATCTCCACTGTGGGCATCGACTTCCGGAATAAAGTTCTGGATGTGGATGGCATGAAGGT
GAAGCTGCAGATCTGGGACACAGCTGGTCAGGAGCGGTTCCGAAGTGTCACCCATGCCTACTACCGAGAT
GCTCACGCACTGTTGCTGCTCTACGACATCACCAACAAAGATTCCTTCGACAACATTCAGGCCTGGTTGA
CAGAGATCCAGGAATATGCCCAGCAGGATGTGGTGCTCATGCTGCTAGGGAACAAGGTTGACTCTACTCA
AGACCGTGTGGTAAAGAGGGAAGATGGGGAGAAATTAGCCAAGGAGTATGGGCTACCTTTCATGGAGACC
AGCGCAAGGACTGGCCTCAACGTGGACTTGGCTTTTACAGCCATAGCAAAGGAGCTGAAACAGAGATCAG
CCAAGGCTCCCAGCGAGCCGCGCTTCAGGCTGCATGACTATGTTAAGAGGGAGGGCCGAGGGGTCTCCTG
CTGTCGACTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_177375
Insert Size 783 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_177375.1, NP_796349.1
RefSeq Size 1434 bp
RefSeq ORF 783 bp
Locus ID 328778
UniProt ID Q504M8
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. Mediates transport of ADRA2A and ADRA2B from the Golgi to the cell membrane. Plays a role in the maturation of zymogenic granules and in pepsinogen secretion in the stomach (By similarity). Plays a role in the secretion of amylase from acinar granules in the parotid gland.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...