Tfpi (NM_001177320) Mouse Untagged Clone

CAT#: MC217756

Tfpi (untagged) - Mouse tissue factor pathway inhibitor (Tfpi), transcript variant 3, (10ug)



  "NM_001177320" in other vectors (3)

CN¥ 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A630013F22Rik; AW552122; EPI; LACI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217756 representing NM_001177320
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGACTTACAAAATGAAGAAAGAATATGCCTTTTGGGCCACTGTGTGTCTGTTGCTTAGCCTTGTTCCCG
AGTTTCTTAATGCTCTGTCTGAGGAAGCTGATGACACAGATTCTGAGCTGGGGTCAATGAAACCGCTACA
TACATTTTGTGCAATGAAGGCAGATGATGGTCCATGCAAAGCAATGATAAGGAGTTATTTTTTCAATATG
TATACTCATCAATGTGAAGAATTTATATACGGGGGATGTGAAGGGAACGAGAACCGATTTGATACCCTGG
AAGAGTGTAAGAAAACATGCATACCAGGTTATGAGAAGACAGCTGTGAAGGCAGCATCTGGAGCAGAAAG
GCCAGATTTCTGCTTCTTGGAAGAGGACCCTGGACTCTGCCGAGGTTACATGAAGAGGTATCTTTATAAC
AACCAGACAAAGCAGTGTGAACGATTCGTGTACGGTGGCTGCCTGGGCAACCGCAACAACTTTGAAACTT
TGGATGAGTGCAAGAAGATCTGTGAGAATCCAGTCCACTCCCCTTCCCCAGTGAATGAGGTACAGATGAG
TGACTACGTAACTGATGGAAATACTGTAACTGATCGCAGTACTGTAAATAACATCGTGGTTCCCCAGTCT
CCCAAAGTGCCCAGGCGTCGGGCTGCCTTGGTACTGTATCACCTTTATGATATTTTGAAAAAACTCATCT
TTGGTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001177320
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001177320.1, NP_001170791.1
RefSeq Size 2993 bp
RefSeq ORF 708 bp
Locus ID 21788
Gene Summary Inhibits factor X (X(a)) directly and, in a Xa-dependent way, inhibits VIIa/tissue factor activity, presumably by forming a quaternary Xa/LACI/VIIa/TF complex. It possesses an antithrombotic action and also the ability to associate with lipoproteins in plasma (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR, 3' UTR, and 3' coding sequence compared to variant 1. The resulting isoform (b) has a shorter and distinct C-terminus compared to isoform a. Variants 2 and 3 both encode isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...