Tank (NM_001164072) Mouse Untagged Clone

CAT#: MC217752

Tank (untagged) - Mouse TRAF family member-associated Nf-kappa B activator (Tank), transcript variant 2, (10ug)



  "NM_001164072" in other vectors (3)

CNY 6,940.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C86182; E430026L09Rik; I-TRAF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217752 representing NM_001164072
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATAAAAACATTGGTGAGCAACTCAATAGAGCATATGAAGCCTTCCGACAGGCATGCATGGATAGAG
ATTCAGCAGTAAGAGAGCTACAGCAAAAGACTGAGAACTATGAACAAAGAATACGCGAGCAACAGGAACA
GCTGTCATTTCAACAAAACCTAATTGACAGGCTGAAATCACAGCTACTTCTCGTGGATTCTAGTCGAGAT
AACAGTTATGGCTATGTACCTTTGCTTGAAGACAGTGACAGAAGGAAGAATAATTTGACCCTTGATGAAC
CACATGATAAAGTGAAACTAGGAACACTGAGAGATAAGCAATCAAAGGTGAGACGACAAGAAGTTTCTTC
TGGAAAAGAATCCGCCAAGGGTCTCAACATCCCTCTGCATCACGAAAGGGATAATATAGAGAAGACTTTC
TGGGACCTTAAAGAAGAATTTCATAGGATTTGCTTGCTAGCAAAAGCACAGAAAGATCACTTAAGCAAAC
TTAATATACCAGATATTGCAACTGACACACAGTGTTCTGTGCCTATACAGTGTACTGATAAAACAGAGAA
ACAAGAAGCGCTGTTTAAGCCCCAGGCTAAAGATGATATAAATAGAGGTATGTCGTGCGTCACAGCTGTC
ACACCAAGAGGACTGGGCCGGGATGAGGAAGATACCTCTTTTGAATCACTTTCTAAATTCAATGTCAAGT
TTCCGCCTATGGACAATGACTCTATTTTTCTACATAGCACTCCAGAGGCCCCGAGCATCCTTGCTCCTGC
CACACCTGAGACAGTGTGCCAGGACCGATTTAATATGGAAGTCAGAGACAACCCAGGAAACTTTGTTAAA
ACAGAAGAAACTTTATTTGAAATTCAGGGAATTGACCCCATAACTTCAGCTATACAAAACCTTAAAACAA
CTGACAAAACAAACCCCTCAAATCTTAGAGCGACGTGTTTGCCAGCTGGAGACCACAATGTGTTCTATGT
AAATACGTTCCCACTTCAAGACCCGCCTGACGCACCTTTTCCCTCACTGGATTCCCCAGGAAAGGCTGTC
CGAGGACCACAGCAGCCCTTTTGGAAGCCTTTTCTTAACCAAGACACTGACTTAGTGGTACCAAGTGATT
CAGACTCAGAGCTCCTTAAACCTCTAGTGTGTGAATTCTGTCAAGAGCTTTTCCCACCATCCATTACATC
CAGAGGGGATTTCCTCCGGCATCTTAATACACACTTTAATGGGGAGACTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164072
Insert Size 1242 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164072.1, NP_001157544.1
RefSeq Size 2019 bp
RefSeq ORF 1242 bp
Locus ID 21353
UniProt ID P70347
Gene Summary Adapter protein involved in I-kappa-B-kinase (IKK) regulation which constitutively binds TBK1 and IKBKE playing a role in antiviral innate immunity. Acts as a regulator of TRAF function by maintaining them in a latent state. Blocks TRAF2 binding to LMP1 and inhibits LMP1-mediated NF-kappa-B activation. Negatively regulates NF-kappaB signaling and cell survival upon DNA damage. Plays a role as an adapter to assemble ZC3H12A, USP10 in a deubiquitination complex which plays a negative feedback response to attenuate NF-kappaB activation through the deubiquitination of IKBKG or TRAF6 in response to interleukin-1-beta (IL1B) stimulation or upon DNA damage. Promotes UBP10-induced deubiquitination of TRAF6 in response to DNA damage. May control negatively TRAF2-mediated NF-kappa-B activation signaled by CD40, TNFR1 and TNFR2. Essential for the efficient induction of IRF-dependent transcription following infection with Sendai virus.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR and uses an alternate in-frame splice site in the central coding region, compared to variant 1. The resulting isoform (2) lacks one internal residue, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...