Sqstm1 (BC006019) Mouse Untagged Clone

CAT#: MC217726

Sqstm1 (untagged) - Mouse sequestosome 1 (cDNA clone MGC:5968 IMAGE:3487289), (10ug)



  "BC006019" in other vectors (6)

CNY 6,940.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
SQSTM1 Rabbit pAb
    • 100 ul

CNY 2,640.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A170, STAP, OSF-6, p62
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC006019
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTCGTTCACGGTGAAGGCCTATCTTCTGGGCAAGGAGGAGGCGACCCGCGAGATCCGCCGCTTCA
GCTTCTGCTTCAGCCCGGAGCCGGAGGCGGAAGCCCAAGCCGCGGCCGGCCCGGGGCCCTGCGAGAGGCT
GCTGAGCCGAGTGGCTGTGCTGTTCCCCACGCTGAGGCCTGGCGGCTTCCAGGCGCACTACCGCGATGAG
GATGGGGACTTGGTTGCCTTTTCCAGTGATGAGGAGCTGACAATGGCTATGTCCTATGTGAAAGATGACA
TCTTCCGCATCTACATTAAAGAGAAGAAGGAGTGCCGGCGGGAACATCGCCCACCATGTGCTCAGGAGGC
ACCCCGAAACATGGTGCACCCCAATGTGATCTGTGATGGTTGCAACGGGCCTGTGGTGGGAACTCGCTAT
AAGTGCAGTGTGTGCCCAGACTACGACCTGTGCAGCGTGTGCGAGGGGAAGGGCCTGCACAGGGAACACA
GCAAGCTCATCTTTCCCAACCCCTTTGGCCACCTCTCTGATAGCTTCTCTCATAGCCGCTGGCTTCGGAA
GCTGAAACATGGACACTTTGGCTGGCCTGGCTGGGAGATGGGCCCACCGGGGAACTGGAGCCCACGTCCT
CCTCGTGCAGGGGATGGCCGCCCTTGCCCTACAGCTGAGTCAGCTTCTGCTCCACCAGAAGATCCCAATG
TCAATTTCCTGAAGAATGTGGGGGAGAGTGTGGCAGCTGCCCTCAGCCCTCTAGGCATTGAGGTTGACAT
TGATGTGGAACATGGAGGGAAGAGAAGCCGCCTGACACCCACTACCCCAGAAAGTTCCAGCACAGGCACA
GAAGACAAGAGTAACACTCAGCCAAGCAGCTGCTCTTCGGAAGTCAGCAAACCTGACGGGGCTGGGGAGG
GCCCTGCTCAGTCTCTGACAGAGCAAATGAAAAAGATAGCCTTGGAGTCGGTGGGACAGCCAGAGGAACA
GATGGAGTCGGGAAACTGCTCAGGAGGAGACGATGACTGGACACATTTGTCTTCAAAAGAAGTGGACCCA
TCTACAGAGGCTGATCCCCGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATGGGTTTCTCGGATGAAG
GCGGCTGGCTCACCAGGCTCCTACAGACCAAGAATTACGACATCGGGGCTGCTCTGGACACGATCCAGTA
TTCGAAGCACCCTCCACCATTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-MluI     
ACCN BC006019
Insert Size 1215 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC006019, AAH06019
RefSeq Size 2013 bp
RefSeq ORF 1214 bp
Locus ID 18412
Gene Summary Autophagy receptor required for selective macroautophagy (aggrephagy). Functions as a bridge between polyubiquitinated cargo and autophagosomes. Interacts directly with both the cargo to become degraded and an autophagy modifier of the MAP1 LC3 family. Required both for the formation and autophagic degradation of polyubiquitin-containing bodies, called ALIS (aggresome-like induced structures) and links ALIS to the autophagic machinery. Involved in midbody ring degradation (By similarity). May regulate the activation of NFKB1 by TNF-alpha, nerve growth factor (NGF) and interleukin-1. May play a role in titin/TTN downstream signaling in muscle cells. May regulate signaling cascades through ubiquitination. Adapter that mediates the interaction between TRAF6 and CYLD (PubMed:14960283, PubMed:18382763). May be involved in cell differentiation, apoptosis, immune response and regulation of K(+) channels. Involved in endosome organization by retaining vesicles in the perinuclear cloud: following ubiquitination by RNF26, attracts specific vesicle-associated adapters, forming a molecular bridge that restrains cognate vesicles in the perinuclear region and organizes the endosomal pathway for efficient cargo transport (By similarity). Promotes relocalization of 'Lys-63'-linked ubiquitinated TMEM173/STING to autophagosomes (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...