Cd36 (NM_007643) Mouse Untagged Clone
CAT#: MC216437
Cd36 (untagged) - Mouse CD36 antigen (Cd36), transcript variant 2, (10ug)
CNY 6,180.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | FAT; GPIV; Scarb3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC216437 representing NM_007643
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCTGTGATCGGAACTGTGGGCTCATTGCTGGAGCTGTTATTGGTGCAGTCCTGGCTGTGTTTGGAG GCATTCTCATGCCAGTCGGAGACATGCTTATTGAGAAGACAATCAAAAGGGAAGTTGTCCTTGAAGAAGG AACCACTGCTTTCAAAAACTGGGTTAAAACAGGCACCACTGTGTACAGACAGTTTTGGATCTTTGATGTG CAAAACCCAGATGACGTGGCAAAGAACAGCAGCAAAATCAAGGTTAAACAAAGAGGTCCTTACACATACA GAGTTCGTTATCTAGCCAAGGAAAATATAACTCAGGACCCCGAGGACCACACTGTGTCTTTTGTACAGCC CAATGGAGCCATCTTTGAGCCTTCACTGTCTGTTGGAACAGAGGATGACAACTTCACAGTTCTGAATCTG GCTGTAGCAGCTGCACCACATATCTACCAAAATTCATTTGTTCAAGTTGTGCTCAACTCTCTTATAAAAA AGTCCAAGTCTTCTATGTTCCAAACAAGATCTTTGAAAGAACTCTTGTGGGGTTACAAAGATCCATTCCT CAGTTTGGTTCCATATCCTATAAGTACCACAGTTGGTGTGTTTTATCCTTACAATGACACTGTAGATGGA GTTTATAAAGTTTTCAATGGAAAGGATAACATAAGCAAAGTTGCCATAATTGAGTCCTATAAAGGGAAAA GGAATTTGTCCTATTGGCCAAGCTATTGCGACATGATTAATGGCACAGACGCAGCCTCCTTTCCACCTTT TGTTGAAAAGTCTCGGACATTGAGATTCTTTTCCTCTGACATTTGCAGGTCTATCTACGCTGTGTTCGGA TCTGAAATCGACCTTAAAGGAATCCCCGTGTACAGATTTGTTCTTCCAGCCAATGCCTTTGCATCACCCC TCCAGAATCCAGACAACCATTGTTTCTGCACTGAAAAAGTAATCTCCAATAACTGTACATCTTATGGTGT GCTAGACATTGGCAAATGCAAAGAAGGAAAGCCTGTGTATATTTCGCTTCCACATTTCCTACATGCAAGT CCAGATGTTTCAGAACCTATTGAAGGCTTACATCCAAATGAAGATGAGCATAGGACATACTTAGATGTGG AACCCATAACTGGATTCACTCTACAATTTGCAAAACGACTGCAGGTCAACATATTGGTCAAGCCAGCTAG AAAAATAGAAGCATTAAAGAATCTGAAGAGACCTTACATTGTACCTATACTGTGGCTAAATGAGACTGGG ACCATTGGTGATGAAAAAGCAGAAATGTTCAAAACACAAGTGACTGGGAAAATCAAGCTCCTTGGCATGG TAGAGATGGCCTTACTTGGGATTGGAGTGGTGATGTTTGTTGCTTTTATGATTTCATATTGTGCTTGCAA ATCCAAGAATGGAAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007643 |
Insert Size | 1419 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007643.4, NP_031669.3 |
RefSeq Size | 3542 bp |
RefSeq ORF | 1419 bp |
Locus ID | 12491 |
UniProt ID | Q08857 |
Gene Summary | Multifunctional glycoprotein that acts as receptor for a broad range of ligands. Ligands can be of proteinaceous nature like thrombospondin, fibronectin, collagen or amyloid-beta as well as of lipidic nature such as oxidized low-density lipoprotein (oxLDL), anionic phospholipids, long-chain fatty acids and bacterial diacylated lipopeptides (PubMed:7685021). They are generally multivalent and can therefore engage multiple receptors simultaneously, the resulting formation of CD36 clusters initiates signal transduction and internalization of receptor-ligand complexes. The dependency on coreceptor signaling is strongly ligand specific. Cellular responses to these ligands are involved in angiogenesis, inflammatory response, fatty acid metabolism, taste and dietary fat processing in the intestine (Probable) (PubMed:19847289, PubMed:20037584, PubMed:23395392). Binds long-chain fatty acids and facilitates their transport into cells, thus participating in muscle lipid utilization, adipose energy storage, and gut fat absorption (By similarity). In the small intestine, plays a role in proximal absorption of dietary fatty acid and cholesterol for optimal chylomicron formation, possibly through the activation of MAPK1/3 (ERK1/2) signaling pathway (By similarity) (PubMed:17507371, PubMed:18753675, PubMed:21610069). Involved in oral fat perception and preferences (PubMed:16276419). Detection into the tongue of long-chain fatty acids leads to a rapid and sustained rise in flux and protein content of pancreatobiliary secretions (By similarity) (PubMed:16276419). In taste receptor cells, mediates the induction of an increase in intracellular calcium levels by long-chain fatty acids, leading to the activation of the gustatory neurons in the nucleus of the solitary tract (PubMed:18162488). Important factor in both ventromedial hypothalamus neuronal sensing of long-chain fatty acid and the regulation of energy and glucose homeostasis (By similarity) (PubMed:23557700). Receptor for thombospondins, THBS1 and THBS2, mediating their antiangiogenic effects (PubMed:15748999). As a coreceptor for TLR4:TLR6 heterodimer, promotes inflammation in monocytes/macrophages. Upon ligand binding, such as oxLDL or amyloid-beta 42, interacts with the heterodimer TLR4:TLR6, the complex is internalized and triggers inflammatory response, leading to NF-kappa-B-dependent production of CXCL1, CXCL2 and CCL9 cytokines, via MYD88 signaling pathway, and CCL5 cytokine, via TICAM1 signaling pathway, as well as IL1B secretion, through the priming and activation of the NLRP3 inflammasome (PubMed:20037584, PubMed:23812099). Selective and nonredundant sensor of microbial diacylated lipopeptide that signal via TLR2:TLR6 heterodimer, this cluster triggers signaling from the cell surface, leading to the NF-kappa-B-dependent production of TNF, via MYD88 signaling pathway and subsequently is targeted to the Golgi in a lipid-raft dependent pathway (By similarity) (PubMed:15690042, PubMed:19847289).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, 3, 4, and 5 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227663 | Cd36 (tGFP-tagged) - Mouse CD36 antigen (Cd36) transcript variant 2, (10ug) |
CNY 3,710.00 |
|
MR227663 | Cd36 (Myc-DDK-tagged) - Mouse CD36 antigen (Cd36), transcript variant 2 |
CNY 3,656.00 |
|
MR227663L3 | Lenti ORF clone of Cd36 (Myc-DDK-tagged) - Mouse CD36 antigen (Cd36), transcript variant 2 |
CNY 5,230.00 |
|
MR227663L4 | Lenti ORF clone of Cd36 (mGFP-tagged) - Mouse CD36 antigen (Cd36), transcript variant 2 |
CNY 5,230.00 |