Sqstm1 (NM_011018) Mouse Untagged Clone
CAT#: MC215799
Sqstm1 (untagged) - Mouse sequestosome 1 (Sqstm1), (10ug)
CN¥ 5,488.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | A170; OSF-6; Osi; p62; STAP; STONE14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NM_011018.2
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTCGTTCACGGTGAAGGCCTATCTTCTGGGCAAGGAGGAGGCGACCCGCGAGATCCGCCGCTTCA GCTTCTGCTTCAGCCCGGAGCCGGAGGCGGAAGCCCAAGCCGCGGCCGGCCCGGGGCCCTGCGAGAGGCT GCTGAGCCGAGTGGCTGTGCTGTTCCCCACGCTGAGGCCTGGCGGCTTCCAGGCGCACTACCGCGATGAG GATGGGGACTTGGTTGCCTTTTCCAGTGATGAGGAGCTGACAATGGCTATGTCCTATGTGAAAGATGACA TCTTCCGCATCTACATTAAAGAGAAGAAGGAGTGCCGGCGGGAACATCGCCCACCATGTGCTCAGGAGGC ACCCCGAAACATGGTGCACCCCAATGTGATCTGTGATGGTTGCAACGGGCCTGTGGTGGGAACTCGCTAT AAGTGCAGTGTGTGCCCAGACTACGACCTGTGCAGCGTGTGCGAGGGGAAGGGCCTGCACAGGGAACACA GCAAGCTCATCTTTCCCAACCCCTTTGGCCACCTCTCTGATAGCTTCTCTCATAGCCGCTGGCTTCGGAA GCTGAAACATGGACACTTTGGCTGGCCTGGCTGGGAGATGGGCCCACCGGGGAACTGGAGCCCACGTCCT CCTCGTGCAGGGGATGGCCGCCCTTGCCCTACAGCTGAGTCAGCTTCTGCTCCACCAGAAGATCCCAATG TCAATTTCCTGAAGAATGTGGGGGAGAGTGTGGCAGCTGCCCTCAGCCCTCTAGGCATTGAGGTTGACAT TGATGTGGAACATGGAGGGAAGAGAAGCCGCCTGACACCCACTACCCCAGAAAGTTCCAGCACAGGCACA GAAGACAAGAGTAACACTCAGCCAAGCAGCTGCTCTTCGGAAGTCAGCAAACCTGACGGGGCTGGGGAGG GCCCTGCTCAGTCTCTGACAGAGCAAATGAAAAAGATAGCCTTGGAGTCGGTGGGACAGCCAGAGGAACA GATGGAGTCGGGAAACTGCTCAGGAGGAGACGATGACTGGACACATTTGTCTTCAAAAGAAGTGGACCCA TCTACAGGTGAACTCCAGTCTCTACAGATGCCAGAATCGGAAGGGCCAAGCTCTCTAGACCCCTCACAGG AAGGACCCACAGGGCTGAAGGAAGCTGCCCTATACCCACATCTCCCACCAGAGGCTGATCCCCGGCTGAT TGAGTCCCTCTCCCAGATGCTGTCCATGGGTTTCTCGGATGAAGGCGGCTGGCTCACCAGGCTCCTACAG ACCAAGAATTACGACATCGGGGCTGCTCTGGACACGATCCAGTATTCGAAGCACCCTCCACCATTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_011018 |
Insert Size | 1329 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_011018.2, NP_035148.1 |
RefSeq Size | 2000 bp |
RefSeq ORF | 1329 bp |
Locus ID | 18412 |
UniProt ID | Q64337 |
Gene Summary | Autophagy receptor required for selective macroautophagy (aggrephagy). Functions as a bridge between polyubiquitinated cargo and autophagosomes. Interacts directly with both the cargo to become degraded and an autophagy modifier of the MAP1 LC3 family. Required both for the formation and autophagic degradation of polyubiquitin-containing bodies, called ALIS (aggresome-like induced structures) and links ALIS to the autophagic machinery. Involved in midbody ring degradation (By similarity). May regulate the activation of NFKB1 by TNF-alpha, nerve growth factor (NGF) and interleukin-1. May play a role in titin/TTN downstream signaling in muscle cells. May regulate signaling cascades through ubiquitination. Adapter that mediates the interaction between TRAF6 and CYLD (PubMed:14960283, PubMed:18382763). May be involved in cell differentiation, apoptosis, immune response and regulation of K(+) channels. Involved in endosome organization by retaining vesicles in the perinuclear cloud: following ubiquitination by RNF26, attracts specific vesicle-associated adapters, forming a molecular bridge that restrains cognate vesicles in the perinuclear region and organizes the endosomal pathway for efficient cargo transport (By similarity). Promotes relocalization of 'Lys-63'-linked ubiquitinated TMEM173/STING to autophagosomes (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
p62/SQSTM1 plays a protective role in oxidative injury of steatotic liver in a mouse hepatectomy model
,Haga, S;Ozawa, T;Yamada, Y;Morita, N;Nagashima, I;Inoue, H;Inaba, Y;Noda, N;Abe, R;Umezawa, K;Ozaki, M;,
Antioxid. Redox Signal.
,PubMed ID 24925527
[Sqstm1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226105 | Sqstm1 (tGFP-tagged) - Mouse sequestosome 1 (Sqstm1), (10ug) |
CN¥ 7,088.00 |
|
MR226105 | Sqstm1 (Myc-DDK-tagged) - Mouse sequestosome 1 (Sqstm1) |
CN¥ 5,488.00 |
|
MR226105L1 | Lenti ORF clone of Sqstm1 (Myc-DDK-tagged) - Mouse sequestosome 1 (Sqstm1) |
CN¥ 7,888.00 |
|
MR226105L2 | Lenti ORF clone of Sqstm1 (mGFP-tagged) - Mouse sequestosome 1 (Sqstm1) |
CN¥ 6,370.00 |
|
MR226105L3 | Lenti ORF clone of Sqstm1 (Myc-DDK-tagged) - Mouse sequestosome 1 (Sqstm1) |
CN¥ 6,370.00 |
|
MR226105L4 | Lenti ORF clone of Sqstm1 (mGFP-tagged) - Mouse sequestosome 1 (Sqstm1) |
CN¥ 7,888.00 |