Batf3 (NM_030060) Mouse Untagged Clone
CAT#: MC214703
Batf3 (untagged) - Mouse basic leucine zipper transcription factor, ATF-like 3 (Batf3), (10ug)
CNY 1,800.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 9130211I03Rik; Snft |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214703 representing NM_030060
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGCAAGGGCCCCCCGCGGTCAGCGTGCTGCAGAGAAGCGTGGATGCGCCCGGGAACCAGCCGCAGA GCCCCAAGGACGATGACAGGAAAGTTCGAAGGAGAGAGAAAAACCGGGTTGCAGCTCAGAGGAGCCGGAA GAAGCAGACCCAGAAGGCTGACAAGCTCCACGAGGAGCACGAGAGCCTGGAGCAGGAGAACTCTGTGCTG CGCAGGGAGATTTCGAAGCTGAAGGAGGAGCTGCGTCACCTGAGCGAGGTGCTGAAGGAGCACGAGAAGA TGTGCCCGCTGCTGCTGTGTCCTATGAACTTTGTGCAGCTTCGGTCAGACCCCGTGGCCAGCTGTCTACC ACGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_030060 |
Insert Size | 357 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC117083, AAI17084 |
RefSeq Size | 712 bp |
RefSeq ORF | 357 bp |
Locus ID | 381319 |
UniProt ID | Q9D275 |
Gene Summary | AP-1 family transcription factor that controls the differentiation of CD8(+) thymic conventional dendritic cells in the immune system. Acts via the formation of a heterodimer with JUN family proteins that recognizes and binds DNA sequence 5'-TGA[CG]TCA-3' and regulates expression of target genes. Required for development of CD8-alpha(+) classical dendritic cells (cDCs) and related CD103(+) dendritic cells that cross-present antigens to CD8 T-cells and produce interleukin-12 (IL12) in response to pathogens.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224969 | Batf3 (tGFP-tagged) - Mouse basic leucine zipper transcription factor ATF-like 3 (Batf3), (10ug) |
CNY 4,370.00 |
|
MR224969 | Batf3 (Myc-DDK-tagged) - Mouse basic leucine zipper transcription factor, ATF-like 3 (Batf3) |
CNY 1,800.00 |
|
MR224969L1 | Lenti ORF clone of Batf3 (Myc-DDK-tagged) - Mouse basic leucine zipper transcription factor, ATF-like 3 (Batf3) |
CNY 5,890.00 |
|
MR224969L2 | Lenti ORF clone of Batf3 (mGFP-tagged) - Mouse basic leucine zipper transcription factor, ATF-like 3 (Batf3) |
CNY 4,200.00 |
|
MR224969L3 | Lenti ORF clone of Batf3 (Myc-DDK-tagged) - Mouse basic leucine zipper transcription factor, ATF-like 3 (Batf3) |
CNY 5,890.00 |
|
MR224969L4 | Lenti ORF clone of Batf3 (mGFP-tagged) - Mouse basic leucine zipper transcription factor, ATF-like 3 (Batf3) |
CNY 4,200.00 |