United States
Germany
Japan
United Kingdom
China
Cxcl3 (NM_203320) Mouse Untagged Clone
CAT＃: MC214575
Cxcl3 (untagged) - Mouse chemokine (C-X-C motif) ligand 3 (Cxcl3), (10ug)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Dci; Dcip1; Gm1960 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC214575 representing NM_203320
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCCTCCCACCTGCCGGCTCCTCAGTGCTGCACTGGTCCTGCTGCTGCTGCTGGCCACCAACCACC AGGCTACAGGGGCTGTTGTGGCCAGTGAGCTGCGCTGTCAGTGCCTGAACACCCTACCAAGGGTTGATTT TGAGACCATCCAGAGCTTGACGGTGACGCCCCCAGGACCCCACTGCACCCAGACAGAAGTCATAGCCACT CTCAAGGATGGTCAAGAAGTTTGCCTCAACCCCCAAGGCCCCAGGCTTCAGATAATCATCAAGAAGATAC TGAAGAGCGGCAAGTCCAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_203320 |
| Insert Size | 303 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC117014, AAI17015 |
| RefSeq Size | 354 bp |
| RefSeq ORF | 303 bp |
| Locus ID | 330122 |
| UniProt ID | Q6W5C0 |
| Gene Summary | This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This secretory protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils. [provided by RefSeq, May 2013] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG216938 | Cxcl3 (tGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 3 (Cxcl3), (10ug) |
CNY 2,800.00 |
|
| MR216938 | Cxcl3 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 3 (Cxcl3) |
CNY 1,200.00 |
|
| MR216938L3 | Lenti ORF clone of Cxcl3 (Myc-DDK-tagged) - Mouse chemokine (C-X-C motif) ligand 3 (Cxcl3) |
CNY 4,750.00 |
|
| MR216938L4 | Lenti ORF clone of Cxcl3 (mGFP-tagged) - Mouse chemokine (C-X-C motif) ligand 3 (Cxcl3) |
CNY 4,750.00 |
