Serpina5 (NM_172953) Mouse Untagged Clone

CAT#: MC214265

Serpina5 (untagged) - Mouse serine (or cysteine) peptidase inhibitor, clade A, member 5 (Serpina5), (10ug)



  "NM_172953" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4933415L04; PAI-3; Pci
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214265 representing NM_172953
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGGTTCTTCCCCATTCTGTGCCTGGTGCTGTTCATCAGCCATGGGGTGGCTTCCCGCCGACACTCCC
ATTCCAAGAAGAAGAAGGCTAAAGAGTCCTCGGTGGGTGCTGTGGGACCTCCCAGTAGCAAAGACTTTGC
TTTCAGACTCTACAGGGCCTTGGTTTCTGAATCCCCTGGTCAGAATGTCTTCTTCTCCCCCTTGAGCGTG
TCTATGAGTTTGGGCATGCTCTCCCTGGGGGCTGGCTTGAAGACGAAGACCCAGATCCTAGATGGCCTAG
GCCTCAGCCTCCAGCAAGGCCAAGAAGACAAGCTCCACAAGGGCTTCCAACAGCTGCTACAGAGATTCAG
GCAGCCTAGTGATGGCCTGCAGCTGAGCCTGGGCAGTGCCCTTTTTAAAGACCCAGCAGTACATATCCGG
GACGACTTCCTGAGTGCCATGAAGACACTGTACATGTCAGACACTTTCTCTACCAACTTTGGGAACCCTG
AAATCGCCAAGAAGCAGATCAACAACTATGTAGCCAAGCAGACCAAGGGCAAGATTGTAGACTTTATCAA
GGATCTTGACAGCACCCATGTCATGATAGTGGTAAATTACATCTTCTTCAAAGCCAAGTGGCAGACGGCC
TTCAGTGAGACAAACACCCACAAGATGGATTTCCATGTGACCCCCAAAAGGACCACACAGGTGCCCATGA
TGAACCGTGAAGATGGGTATTCCTACTACCTGGACCAAAACATCTCCTGCACGGTGGTGGGGATCCCTTA
TCAAGGCAATGCCATCGCTCTATTTATTCTCCCCAGCGAGGGCAAGATGAAGCAGGTGGAGGATGGCCTG
GATGAGAGAACATTGAGGAACTGGCTTAAGATGTTCACCAAAAGACGCTTAGATCTTTACCTCCCCAAGT
TCTCCATTGAGGCTACCTACAAACTGGAAAATGTCCTCCCCAAGCTGGGCATCCAGGACGTCTTCACCAC
CCATGCTGACTTGTCTGGCATTACTGACCATACCAATATCAAGTTGTCTGAGATGGTGCACAAATCCATG
ATGGAGGTTGAAGAGTCAGGAACCACAGCAGCTGCCATCACAGGAGCCATCTTCACATTCAGATCTGCTC
GGCCGAGCTCCCTGAAGATAGAATTCACCAGACCCTTTCTGCTGACCCTTATGGAGGATTCACATATACT
TTTCGTTGGCAAGGTGACCCGGCCCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_172953
Insert Size 1218 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_172953.3, NP_766541.2
RefSeq Size 2162 bp
RefSeq ORF 1218 bp
Locus ID 268591
UniProt ID P70458
Gene Summary Heparin-dependent serine protease inhibitor acting in body fluids and secretions. Inactivates serine proteases by binding irreversibly to their serine activation site. Involved in the regulation of intravascular and extravascular proteolytic activities. Plays hemostatic roles in the blood plasma. Acts as a procoagulant and proinflammatory factor by inhibiting the anticoagulant activated protein C factor as well as the generation of activated protein C factor by the thrombin/thrombomodulin complex. Acts as an anticoagulant factor by inhibiting blood coagulation factors like prothrombin, factor XI, factor Xa, plasma kallikrein and fibrinolytic enzymes such as tissue- and urinary-type plasminogen activators. In seminal plasma, inactivates several serine proteases implicated in the reproductive system. Inhibits the serpin acrosin; indirectly protects component of the male genital tract from being degraded by excessive released acrosin. Inhibits tissue-and urinary-type plasminogen activator, prostate-specific antigen and kallikrein activities; has a control on the sperm motility and fertilization. Inhibits the activated protein C-catalyzed degradation of SEMG1 and SEMG2; regulates the degradation of semenogelin during the process of transfer of spermatozoa from the male reproductive tract into the female tract. In urine, inhibits urinary-type plasminogen activator and kallikrein activities. Inactivates membrane-anchored serine proteases activities such as MPRSS7 and TMPRSS11E. Inhibits urinary-type plasminogen activator-dependent tumor cell invasion and metastasis. May also play a non-inhibitory role in seminal plasma and urine as a hydrophobic hormone carrier by its binding to retinoic acid (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...