United States
Germany
Japan
United Kingdom
China
Nppa (NM_008725) Mouse Untagged Clone
CAT＃: MC212904
Nppa (untagged) - Mouse natriuretic peptide type A (Nppa), (10ug)
CNY 1,800.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | A; Anf; ANP; CDD; P; Pnd |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC212904 representing NM_008725
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGCTCCTTCTCCATCACCCTGGGCTTCTTCCTCGTCTTGGCCTTTTGGCTTCCAGGCCATATTGGAG CAAATCCTGTGTACAGTGCGGTGTCCAACACAGATCTGATGGATTTCAAGAACCTGCTAGACCACCTGGA GGAGAAGATGCCGGTAGAAGATGAGGTCATGCCCCCGCAGGCCCTGAGTGAGCAGACTGAGGAAGCAGGG GCCGCACTTAGCTCCCTCCCCGAGGTGCCTCCCTGGACTGGGGAGGTCAACCCACCTCTGAGAGACGGCA GTGCTCTAGGGCGCAGCCCCTGGGACCCCTCCGATAGATCTGCCCTCTTGAAAAGCAAACTGAGGGCTCT GCTCGCTGGCCCTCGGAGCCTACGAAGATCCAGCTGCTTCGGGGGTAGGATTGACAGGATTGGAGCCCAG AGTGGACTAGGCTGCAACAGCTTCCGGTACCGAAGATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008725 |
| Insert Size | 459 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_008725.3, NP_032751.1 |
| RefSeq Size | 844 bp |
| RefSeq ORF | 459 bp |
| Locus ID | 230899 |
| UniProt ID | P05125 |
| Gene Summary | This gene encodes members of the natriuretic family of peptides that play an important role in the control of extracellular fluid volume and electrolyte homeostasis. The encoded protein precursor undergoes proteolytic processing to generate multiple functional peptides. Mice lacking the encoded peptides exhibit salt-sensitive hypertension. The transgenic overexpression of the encoded peptides in mice decreases arterial blood pressure without inducing diuresis and natriuresis. This gene is located adjacent to another member of the natriuretic family of peptides on chromosome 4. [provided by RefSeq, Oct 2015] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227047 | Nppa (tGFP-tagged) - Mouse natriuretic peptide precursor type A (Nppa), (10ug) |
CNY 4,370.00 |
|
| MR227047 | Nppa (Myc-DDK-tagged) - Mouse natriuretic peptide type A (Nppa) |
CNY 1,800.00 |
|
| MR227047L3 | Lenti ORF clone of Nppa (Myc-DDK-tagged) - Mouse natriuretic peptide type A (Nppa) |
CNY 5,890.00 |
|
| MR227047L4 | Lenti ORF clone of Nppa (mGFP-tagged) - Mouse natriuretic peptide type A (Nppa) |
CNY 5,890.00 |
