Gpr55 (NM_001033290) Mouse Untagged Clone
CAT#: MC212799
Gpr55 (untagged) - Mouse G protein-coupled receptor 55 (Gpr55), (10ug)
CN¥ 2,400.00
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CTFL; Gm218; Lpir1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC212799 representing NM_001033290
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001033290 |
Insert Size | 984 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033290.2, NP_001028462.2 |
RefSeq Size | 2550 bp |
RefSeq ORF | 984 bp |
Locus ID | 227326 |
UniProt ID | Q3UJF0 |
Gene Summary | Receptor for L-alpha-lysophosphatidylinositol (LPI). LPI induces Ca(2+) release from intracellular stores via the heterotrimeric G protein GNA13 and RHOA (By similarity). Putative cannabinoid receptor (By similarity). May play a role in bone physiology by regulating osteoclast number and function (By similarity). May be involved in hyperalgesia associated with inflammatory and neuropathic pain.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222607 | Gpr55 (tGFP-tagged) - Mouse G protein-coupled receptor 55 (Gpr55), (10ug) |
CN¥ 4,000.00 |
|
MR222607 | Gpr55 (Myc-DDK-tagged) - Mouse G protein-coupled receptor 55 (Gpr55) |
CN¥ 2,400.00 |
|
MR222607L3 | Lenti ORF clone of Gpr55 (Myc-DDK-tagged) - Mouse G protein-coupled receptor 55 (Gpr55) |
CN¥ 4,750.00 |
|
MR222607L4 | Lenti ORF clone of Gpr55 (mGFP-tagged) - Mouse G protein-coupled receptor 55 (Gpr55) |
CN¥ 4,750.00 |