United States
Germany
Japan
United Kingdom
China
Nmnat2 (NM_175460) Mouse Untagged Clone
CAT＃: MC212784
Nmnat2 (untagged) - Mouse nicotinamide nucleotide adenylyltransferase 2 (Nmnat2), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI843915; D030041I09Rik; PNAT1; PNAT2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_175460, the custom clone sequence may differ by one or more nucleotides
ATGACCGAGACCACAAAGACCCACGTTATCCTGCTGGCCTGCGGCAGCTTCAATCCCATCACTAAAGGGC ACATTCAGATGTTCGAGAGAGCCAGGGATTATCTGCACAAGACTGGAAGATTTATTGTGATTGGCGGGAT TGTCTCTCCGGTCCATGACTCCTACGGAAAACAGGGCCTTGTGTCAAGTCGGCACCGTCTCATCATGTGT CAGCTGGCTGTCCAGAATTCCGACTGGATCAGGGTGGACCCATGGGAGTGCTATCAGGACACCTGGCAGA CAACCTGCAGTGTGTTGGAGCACCATCGAGACCTGATGAAGAGGGTGACCGGCTGCATCCTCTCCAACGT CAACACACCTTCCATGACACCTGTGATCGGACAGCCACAGCATGAGAACACCCAGCCCATTTACCAGAAC AGCAATGTGCCCACCAAGCCCACTGCAGCCAAGATCTTGGGAAAGGTGGGAGAAAGCCTCAGCCGGATCT GCTGCGTCCGCCCACCAGTGGAGCGCTTCACTTTTGTAGATGAGAACGCCAACCTGGGCACAGTGATGCG GTATGAGGAGATCGAGCTGCGCATCTTGCTGCTGTGTGGTAGTGACCTGCTGGAGTCTTTCTGCATCCCA GGACTCTGGAATGAGGCAGATATGGAAGTGATTGTTGGGGACTTTGGGATCGTCGTGGTACCCAGGGATG CAGCGGACACAGACCGGATCATGAATCACTCCTCCATACTCCGCAAGTACAAAAACAACATCATGGTTGT GAAGGATGATATCAACCATCCCATGTCTGTAGTCAGCTCCACCAAGAGCAGGCTGGCCCTGCAGCATGGG GACGGCCATGTTGTGGATTACCTGTCCCAGCCAGTCATCGATTACATCCTCAAGAGTCAGCTGTACATCA ACGCCTCGGGCTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_175460 |
| Insert Size | 924 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC089007, AAH89007 |
| RefSeq Size | 4548 bp |
| RefSeq ORF | 924 bp |
| Locus ID | 226518 |
| UniProt ID | Q8BNJ3 |
| Gene Summary | Nicotinamide/nicotinate-nucleotide adenylyltransferase that acts as an axon maintenance factor (PubMed:20126265, PubMed:23082226). Catalyzes the formation of NAD(+) from nicotinamide mononucleotide (NMN) and ATP (By similarity). Can also use the deamidated form; nicotinic acid mononucleotide (NaMN) as substrate but with a lower efficiency (By similarity). Cannot use triazofurin monophosphate (TrMP) as substrate (By similarity). Also catalyzes the reverse reaction, i.e. the pyrophosphorolytic cleavage of NAD(+) (By similarity). For the pyrophosphorolytic activity prefers NAD(+), NADH and NaAD as substrates and degrades nicotinic acid adenine dinucleotide phosphate (NHD) less effectively (By similarity). Fails to cleave phosphorylated dinucleotides NADP(+), NADPH and NaADP(+) (By similarity). Axon survival factor required for the maintenance of healthy axons: acts by delaying Wallerian axon degeneration, an evolutionarily conserved process that drives the loss of damaged axons (PubMed:20126265, PubMed:23082226).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204325 | Nmnat2 (tGFP-tagged) - Mouse nicotinamide nucleotide adenylyltransferase 2 (Nmnat2) |
CNY 4,000.00 |
|
| MR204325 | Nmnat2 (Myc-DDK-tagged) - Mouse nicotinamide nucleotide adenylyltransferase 2 (Nmnat2) |
CNY 2,400.00 |
|
| MR204325L3 | Lenti ORF clone of Nmnat2 (Myc-DDK-tagged) - Mouse nicotinamide nucleotide adenylyltransferase 2 (Nmnat2) |
CNY 4,750.00 |
|
| MR204325L4 | Lenti ORF clone of Nmnat2 (mGFP-tagged) - Mouse nicotinamide nucleotide adenylyltransferase 2 (Nmnat2) |
CNY 4,800.00 |
