Nmnat2 (NM_175460) Mouse Untagged Clone

CAT#: MC212784

Nmnat2 (untagged) - Mouse nicotinamide nucleotide adenylyltransferase 2 (Nmnat2), (10ug)



  "NM_175460" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI843915; D030041I09Rik; PNAT1; PNAT2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_175460, the custom clone sequence may differ by one or more nucleotides


ATGACCGAGACCACAAAGACCCACGTTATCCTGCTGGCCTGCGGCAGCTTCAATCCCATCACTAAAGGGC
ACATTCAGATGTTCGAGAGAGCCAGGGATTATCTGCACAAGACTGGAAGATTTATTGTGATTGGCGGGAT
TGTCTCTCCGGTCCATGACTCCTACGGAAAACAGGGCCTTGTGTCAAGTCGGCACCGTCTCATCATGTGT
CAGCTGGCTGTCCAGAATTCCGACTGGATCAGGGTGGACCCATGGGAGTGCTATCAGGACACCTGGCAGA
CAACCTGCAGTGTGTTGGAGCACCATCGAGACCTGATGAAGAGGGTGACCGGCTGCATCCTCTCCAACGT
CAACACACCTTCCATGACACCTGTGATCGGACAGCCACAGCATGAGAACACCCAGCCCATTTACCAGAAC
AGCAATGTGCCCACCAAGCCCACTGCAGCCAAGATCTTGGGAAAGGTGGGAGAAAGCCTCAGCCGGATCT
GCTGCGTCCGCCCACCAGTGGAGCGCTTCACTTTTGTAGATGAGAACGCCAACCTGGGCACAGTGATGCG
GTATGAGGAGATCGAGCTGCGCATCTTGCTGCTGTGTGGTAGTGACCTGCTGGAGTCTTTCTGCATCCCA
GGACTCTGGAATGAGGCAGATATGGAAGTGATTGTTGGGGACTTTGGGATCGTCGTGGTACCCAGGGATG
CAGCGGACACAGACCGGATCATGAATCACTCCTCCATACTCCGCAAGTACAAAAACAACATCATGGTTGT
GAAGGATGATATCAACCATCCCATGTCTGTAGTCAGCTCCACCAAGAGCAGGCTGGCCCTGCAGCATGGG
GACGGCCATGTTGTGGATTACCTGTCCCAGCCAGTCATCGATTACATCCTCAAGAGTCAGCTGTACATCA
ACGCCTCGGGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_175460
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC089007, AAH89007
RefSeq Size 4548 bp
RefSeq ORF 924 bp
Locus ID 226518
UniProt ID Q8BNJ3
Gene Summary Nicotinamide/nicotinate-nucleotide adenylyltransferase that acts as an axon maintenance factor (PubMed:20126265, PubMed:23082226). Catalyzes the formation of NAD(+) from nicotinamide mononucleotide (NMN) and ATP (By similarity). Can also use the deamidated form; nicotinic acid mononucleotide (NaMN) as substrate but with a lower efficiency (By similarity). Cannot use triazofurin monophosphate (TrMP) as substrate (By similarity). Also catalyzes the reverse reaction, i.e. the pyrophosphorolytic cleavage of NAD(+) (By similarity). For the pyrophosphorolytic activity prefers NAD(+), NADH and NaAD as substrates and degrades nicotinic acid adenine dinucleotide phosphate (NHD) less effectively (By similarity). Fails to cleave phosphorylated dinucleotides NADP(+), NADPH and NaADP(+) (By similarity). Axon survival factor required for the maintenance of healthy axons: acts by delaying Wallerian axon degeneration, an evolutionarily conserved process that drives the loss of damaged axons (PubMed:20126265, PubMed:23082226).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...