Kctd11 (NM_153143) Mouse Untagged Clone

CAT#: MC212654

Kctd11 (untagged) - Mouse potassium channel tetramerisation domain containing 11 (Kctd11), (10ug)



  "NM_153143" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AF465352; Ren
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212654 representing NM_153143
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGGGGGCCATGTTTAGGGCTGACACCCTAATGCCAGCCAACCTTAACCCGCAAGGAGATGGCCATT
ACTTCATCGACAGGGATGGCAAGGCTTTCCGGCACATCCTCAATTTTTTGCGGCTAGGCCGTCTGGACCT
GCCCCGTGGGTACGGAGAAACTGCCCTTCTTAAGGCAGAGGCTGACTTCTACCAGATCCGGCCCCTCCTG
GATGCCCTGCGGGAATTGGAAGCCTCTCGGGGTACACCTGCATCCACAGCCGCCCTACTCCATGCAGATG
TAGATGTCAGCCCCCGCCAGGTGCACTTCTCCGCTCGAAGGGGCCCCCACCACTATGAGCTGAGCTCTGT
CCAGGTGGACACCTTCCGAGCCAACCTCTTCTGCACTGACCCTGAGTGTCTGGCTGCCATGCGCAACAGA
TTTGGTGTGGCCATTGGGGACAGGGCAGAAGGAGGTCCACATTTTCGGCTAGAGTGGGCCTCCCGCCCCC
AGGAACTCCCTGAAGTAGAGTATCAAAGACTGGGGCTGCAGCCACTGTGGACTGGGGGGCCAGAAGATCG
TCGGGAGGTAGCGAACACGCCTACATTCCTGGAGGAGGTGCTACGGGTGGCTCTGGAACATGGCTTCCGC
CTGGACTCTGTCTTCCCAGACCCTGAAGACCTTCTGAACTCTAGATCCTTGCGCTTTGTGCGCCACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_153143
Insert Size 699 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153143.4, NP_694783.1
RefSeq Size 2740 bp
RefSeq ORF 699 bp
Locus ID 216858
UniProt ID Q8K485
Gene Summary Plays a role as a marker and a regulator of neuronal differentiation; Up-regulated by a variety of neurogenic signals, such as retinoic acid, epidermal growth factor/EGF and NGFB/nerve growth factor. Induces apoptosis, growth arrest and the expression of cyclin-dependent kinase inhibitor CDKN1B. Plays a role as a tumor repressor and inhibits cell growth and tumorigenicity of medulloblastoma (MDB). Acts as probable substrate-specific adapter for a BCR (BTB-CUL3-RBX1) E3 ubiquitin-protein ligase complex towards HDAC1. Functions as antagonist of the Hedgehog pathway on cell proliferation and differentiation by affecting the nuclear transfer of transcription factor GLI1, thus maintaining cerebellar granule cells in undifferentiated state, this effect probably occurs via HDAC1 down-regulation, keeping GLI1 acetylated and inactive. When knock-down, Hedgehog antagonism is impaired and proliferation of granule cells is sustained. Activates the caspase cascade.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...