Cldn16 (NM_053241) Mouse Untagged Clone

CAT#: MC212266

Cldn16 (untagged) - Mouse claudin 16 (Cldn16), (10ug)



  "NM_053241" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms claudi; claudin-16; PC; PCLN1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212266 representing NM_053241
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGGATCTTCTTCAGTACGCTGCCTGCTTCTTGGCCATATTCTCCACTGGGTTTTTGATCGTGGCCA
CCTGGACAGACTGTTGGATGGTGAACGCTGATGACTCCCTGGAGGTGAGCACTAAATGCAGAGGCCTGTG
GTGGGAGTGTGTAACAAACGCTTTTGATGGGATTCGAACCTGCGATGAGTACGACTCCATATATGCAGAA
CATCCCTTGAAGCTGGTGGTAACTCGAGCACTGATGATCACAGCTGACATTTTAGCTGGCTTTGGATTCA
TCACCCTGCTCCTTGGTCTGGACTGTGTGAAGTTCCTACCTGATGACCCACAAATTAAAGTCCGCCTTTG
CTTTGTTGCAGGGACCACATTACTCATTGCAGGTACCCCAGGAATCATCGGTTCTGTGTGGTATGCTGTG
GATGTTTACGTCGAACGCTCCTCTCTCGTTTTACACAATATATTTCTTGGGATCCAATATAAATTTGGTT
GGTCCTGCTGGCTTGGAATGGCTGGGTCTTTGGGTTGCTTTTTGGCAGGAGCTCTCCTCACCTGCTGTTT
GTACCTCTTCAAAGATGTTGGGCCTGAGAGGAACTACCCTTATGCCATGAGGAAGCCCTATTCAACTGCA
GGTGTGTCCATGGCCAAGTCCTACAAGGCCCCTCGGACAGAGACAGCCAAAATGTATGCTGTAGACACCA
GAGTATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_053241
Insert Size 708 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_053241.5, NP_444471.1
RefSeq Size 1173 bp
RefSeq ORF 708 bp
Locus ID 114141
UniProt ID Q925N4
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is critical for renal paracellular epithelial transport of Ca(2+) and Mg(2+) in the thick ascending loop of Henle. The gene deficiency leads to specific alterations in renal Ca(2+) and Mg(2+) balance and also to disturbances in Na(+) handling. The interaction of this gene and the Cldn 19 gene is required for their assembly into tight junctions and for renal Mg(2+) reabsorption. This gene and the Cldn1 gene are clustered on chromosome 16. [provided by RefSeq, Aug 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...