Clps (NM_025469) Mouse Untagged Clone

CAT#: MC212216

Clps (untagged) - Mouse colipase, pancreatic (Clps), (10ug)



  "NM_025469" in other vectors (4)

CN¥ 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2200003J09Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212216 representing NM_025469
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAAGGTCCTTGTTCTTCTGCTTGTGTCCCTCCTTGCAGTGGCCTATGCAGCTCCCGGACCCCGGG
GTCTTATTATCAACCTGGAGGACGGTGAGATCTGTTTGAACAGTATGCAGTGTAAGAGCAGATGCTGCCA
ACATGACACCATCCTGGGCATTGCCCGTTGCACACACAAGGCCATGGAGAACAGCGAGTGCTCCCCAAAG
ACCCTCTATGGGATCTACTACCGGTGTCCCTGTGAGCGGGGCCTGACCTGTGAGGGGGACAGGAGCATCA
TCGGCGCCATCACCAACACCAACTATGGCATCTGCCTCGACTCCAGGCGCTCCAAGCAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025469
Insert Size 342 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_025469.3, NP_079745.1
RefSeq Size 557 bp
RefSeq ORF 342 bp
Locus ID 109791
UniProt ID Q9CQC2
Gene Summary This gene encodes a member of the colipase family of coenzymes that is required for the optimal activity of pancreatic lipase. The encoded protein undergoes proteolytic processing to generate a mature polypeptide that binds to the lipase and prevents inhibition by bile acids. Over half of the mice lacking the encoded protein die within two weeks of birth while the remaining ones exhibit fat malabsorption and altered body weight regulation. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...