Hmgn3 (NM_026122) Mouse Untagged Clone

CAT#: MC212018

Hmgn3 (untagged) - Mouse high mobility group nucleosomal binding domain 3 (Hmgn3), transcript variant a, (10ug)



  "NM_026122" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110002A15Rik; 6330514M13Rik; BB071015; TRIP7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC212018 representing NM_026122
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCGAAGAGAAAGTCTCCCGAGAACACAGAGGGCAAAGATGGAACCAAGCTAACTAAGCAGGAGCCCA
CAAGACGGTCGGCCAGGTTGTCCGCGAAACCTGTTCCACCAAAACCGGAGTCTAAACCAAGAAAAACATC
AGCTAAGAAAGAACCTGGAACAAAGATTAGCAGAGGTGCTAAGGGGAAGAAGGAAGAAAAGCAGGAAGCT
GGAGAGGAAGGTACTGCACCATCTGCAAATGGTGACACTAAAGTTGAAGAGGCACAGAGAACTGAATCTA
TAGAAAAGGAGGGAGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_026122
Insert Size 300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_026122.4, NP_080398.1
RefSeq Size 923 bp
RefSeq ORF 300 bp
Locus ID 94353
UniProt ID Q9DCB1
Gene Summary Binds to nucleosomes, regulating chromatin structure and consequently, chromatin-dependent processes such as transcription, DNA replication and DNA repair. Affects both insulin and glucagon levels and modulates the expression of pancreatic genes involved in insulin secretion. Regulates the expression of the glucose transporter SLC2A2 by binding specifically to its promoter region and recruiting PDX1 and additional transcription factors. Regulates the expression of SLC6A9, a glycine transporter which regulates the glycine concentration in synaptic junctions in the central nervous system, by binding to its transcription start site. May play a role in ocular development and astrocyte function.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (a) encodes the longer isoform (Hmgn3a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...