Arpp21 (NM_028755) Mouse Untagged Clone
CAT#: MC211487
Arpp21 (untagged) - Mouse cyclic AMP-regulated phosphoprotein, 21 (Arpp21), transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 0710001E13Rik; AI853636; ARPP-21; D9Bwg1012e; R3hdm3; Tarpp |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC211487 representing NM_028755
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGAGCAAGGAGGACTGACTCCGACCATACTGGAAGAAGGGCAGACGGAGCCAGAGTCTGCCCCAG AAAATGGCATCCTCAAGTCAGAAAGTCTGGATGAGGAGGAGAAGCTGGAACTGCAGCGGCGACTGGCGGC TCAGAACCAAGAGAGGAGAAAATCCAAGTCAGGAGCAGGCAAAGGGAAGCTGACCAGAAGTCTTGCTGTC TGTGAAGAGTCTTCAGCTAGATCTGGAGGGGAAAGTCACCAGGATCAGACTCTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_028755 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_028755.3, NP_083031.1 |
RefSeq Size | 3328 bp |
RefSeq ORF | 267 bp |
Locus ID | 74100 |
UniProt ID | Q9DCB4 |
Gene Summary | Isoform 2 may act as a competitive inhibitor of calmodulin-dependent enzymes such as calcineurin in neurons.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1), as well as variants 8-19, encodes isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222988 | Arpp21 (tGFP-tagged) - Mouse cyclic AMP-regulated phosphoprotein 21 (Arpp21) transcript variant 1, (10ug) |
CNY 2,850.00 |
|
MR222988 | Arpp21 (Myc-DDK-tagged) - Mouse cyclic AMP-regulated phosphoprotein, 21 (Arpp21), transcript variant 1 |
CNY 1,200.00 |
|
MR222988L3 | Lenti ORF clone of Arpp21 (Myc-DDK-tagged) - Mouse cyclic AMP-regulated phosphoprotein, 21 (Arpp21), transcript variant 1 |
CNY 4,750.00 |
|
MR222988L4 | Lenti ORF clone of Arpp21 (mGFP-tagged) - Mouse cyclic AMP-regulated phosphoprotein, 21 (Arpp21), transcript variant 1 |
CNY 4,750.00 |