Pitpnc1 (NM_145823) Mouse Untagged Clone

CAT#: MC211221

Pitpnc1 (untagged) - Mouse phosphatidylinositol transfer protein, cytoplasmic 1 (Pitpnc1), (10ug)



  "NM_145823" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Pitpnc1 Antibody - middle region
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110020B03Rik; 5830436L09Rik; AI662802; AI851387; C330017I21Rik; Dnr411; rdgB-beta; RDGBB; RDGBB1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC211221 representing NM_145823
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTGCTCAAGGAGTACCGAATCTGCATGCCGCTCACCGTGGACGAGTACAAAATCGGACAGCTGTATA
TGATCAGCAAACACAGCCATGAGCAGAGTGACCGGGGAGAAGGGGTAGAGGTCGTGCAGAACGAGCCCTT
TGAGGACCCTCACCATGGCAACGGGCAGTTCACTGAGAAGCGAGTGTATCTCAACAGCAAGCTGCCTAGT
TGGGCCAGAGCTGTTGTTCCCAAAATATTTTATGTGACCGAGAAGGCGTGGAATTATTACCCATACACCA
TCACAGAATACACTTGTTCCTTCCTGCCGAAATTCTCCATCCACATAGAAACCAAGTATGAAGACAACAA
GGGAAGCAACGATAGTATTTTTGACAGTGAAGCCAAAGACCTCGAGAGAGAAGTGTGCTTCATCGATATC
GCCTGTGATGAAATTCCAGAACGCTACTACAAAGAGTCTGAGGATCCTAAACACTTCAAGTCTGAGAAGA
CAGGCCGAGGGCAGCTAAGAGAAGGCTGGCGAGACAACCATCAACCCATCATGTGCTCCTACAAGCTGGT
CACCGTCAAGTTCGAGGTGTGGGGCCTTCAGACCCGAGTGGAACAATTTGTGCACAAGGTGGTCCGAGAC
ATCTTGCTGATTGGACACAGACAGGCCTTTGCGTGGGTTGATGAGTGGTACGATATGACAATGGATGATG
TTCGGGAATACGAGAAAAACATGCATGAACAAACCAACATAAAAGTTTGCAATCAGCACTCCTCCACTGT
GGATGACATAGAGAGCCATGCACAGACCAGTACATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_145823
Insert Size 807 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145823.2, NP_665822.1
RefSeq Size 6350 bp
RefSeq ORF 807 bp
Locus ID 71795
UniProt ID Q8K4R4
Gene Summary Phosphatidylinositol transfer proteins mediate the monomeric transport of lipids by shielding a lipid from the aqueous environment and binding the lipid in a hydrophobic cavity. Able to transfer phosphatidylinositol in vitro. Isoform 2 specifically binds to phosphatidylinositol but not to other phospholipids and may play a role in the phosphoinositide-mediated signaling in the neural development.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate exon in its 3' coding region, resulting in a frameshift and a premature stop codon, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...