Nsmce2 (NM_026746) Mouse Untagged Clone

CAT#: MC210733

Nsmce2 (untagged) - Mouse non-SMC element 2 homolog (MMS21, S. cerevisiae) (Nsmce2), transcript variant 1, (10ug)



  "NM_026746" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110014D18Rik; AI661537
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210733 representing NM_026746
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAGGACGGTCCAGTACAAGTTCAGGTTCTACCCGTTACATATCCTTCAGTGGCATAGAGTCAGCTC
TCTCCTCCTTAAAAAACTTCCAATCCTGTATCAGCTCTGGAATGGACACAGTTTCTAGTGTTGCCTTGGA
CCTTGTGGAGACTCAAACTGAAGTGAGTAGTGAGTACAGTATGGACAAGGCCATGGTTGAGTTTGCTAAA
ATGGATCGAGAACTAAGCCATTATGTTAAGGCTGTGCAGTCTACAATCAATCATGTAAAAGAAGAACGTC
CAGAAAAAGTACCAGATTTAAAATTACTGGTAGAGAAGAAATTTTTGGCTTTACAGGATAAGAACTCTGA
TGCCGACTTTAAAGAGAATGAAAAGTTCGTGCAGTTCAAGCAACAGCTGAGGGAGCTGAAGAAGCAATAT
GGTATTCATGCAGACAGAGAGAATGATCTGACAGAAGGAGTTGACGAAGATATGATTGTGACCCAGAGCC
AAACCAATTTCATCTGCCCCATAACACAGCTGGAAATGAAGAAGCCAGTGAAAAATAAAATGTGTGGCCA
TACATACGAAGAGGAAGCCATTGTTCGCATGATTGAATCCAAGCATAAGAGGAAGAAGAAGGCCTGTTGC
CCCAAAATTGGCTGTAGCCACACAGACATGAGAATGTCAGATCTCATTCCGGATGAAGCCCTGAGAAGGG
CAATCGAGAGCCACAACAAGAAGAAAAAACGCCACTCCGAATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_026746
Insert Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_026746.3, NP_081022.2
RefSeq Size 1159 bp
RefSeq ORF 744 bp
Locus ID 68501
UniProt ID Q91VT1
Gene Summary E3 SUMO-protein ligase component of the SMC5-SMC6 complex, a complex involved in repair of DNA double-strand breaks by homologous recombination. Is not be required for the stability of the complex. The complex may promote sister chromatid homologous recombination by recruiting the SMC1-SMC3 cohesin complex to double-strand breaks. The complex is required for telomere maintenance via recombination and mediates sumoylation of shelterin complex (telosome) components. Acts as an E3 ligase mediating SUMO attachment to various proteins such as SMC6L1 and TRAX, the shelterin complex subunits TERF1, TERF2, TINF2 and TERF2IP, and maybe the cohesin components RAD21 and STAG2. Required for recruitment of telomeres to PML nuclear bodies. SUMO protein-ligase activity is required for the prevention of DNA damage-induced apoptosis by facilitating DNA repair. Required for sister chromatid cohesion during prometaphase and mitotic progression (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer variant and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...