Rnf41 (NM_001164237) Mouse Untagged Clone

CAT#: MC210575

Rnf41 (untagged) - Mouse ring finger protein 41 (Rnf41), transcript variant 1, (10ug)



  "NM_001164237" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2210404G21Rik; 4930511A05Rik; 4933415P08Rik; D10Ertd722e; FLRF; Nrdp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210575 representing NM_001164237
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGTATGATGTGACCCGTTTCCAGGGGGACGTTGACGAGGACCTTATCTGCCCTATTTGCAGTGGAG
TCTTGGAGGAGCCAGTGCAGGCGCCTCATTGTGAGCATGCCTTCTGCAACGCCTGCATCACCCAATGGTT
CTCTCAGCAGCAGACGTGTCCGGTAGACCGTAGCGTTGTCACGGTTGCCCACCTGCGCCCAGTACCTCGG
ATCATGCGGAACATGTTGTCAAAGCTACAGATTGCCTGTGACAACGCTGTGTTTGGCTGCAGTGCTGTTG
TCAGGCTTGACAACCTCATGTCCCACCTCAGTGACTGTGAGCACAACCCGAAGCGGCCTGTGACCTGTGA
GCAGGGCTGTGGCCTGGAGATGCCCAAAGATGAACTGCCAAACCACAATTGCATTAAGCACCTGCGCTCC
GTGGTCCAGCAGCAGCAGTCGCGCATTGCAGAGCTGGAGAAGACCTCGGCTGAACACAAGCACCAGCTGG
CAGAGCAGAAGCGAGACATTCAGCTGCTGAAGGCGTATATGCGAGCCATCCGCAGTGTCAACCCCAACCT
TCAGAACCTGGAGGAGACAATCGAATACAATGAGATCCTCGAGTGGGTGAACTCCCTGCAGCCGGCAAGG
GTGACCCGCTGGGGGGGCATGATCTCCACTCCTGATGCTGTGCTCCAGGCTGTCATCAAGCGCTCCCTCG
TGGAAAGTGGCTGCCCGGCCTCCATCGTCAACGAGCTGATTGAAAATGCCCATGAACGCAGCTGGCCCCA
GGGTCTGGCCACACTAGAGACAAGACAGATGAACCGGCGCTACTATGAGAACTACGTGGCCAAGCGCATC
CCTGGCAAGCAGGCTGTAGTGGTGATGGCCTGTGAGAACCAGCACATGGGGGACGACATGGTGCAGGAGC
CAGGGCTCGTCATGATATTTGCGCATGGTGTGGAGGAGATATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001164237
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001164237.1, NP_001157709.1
RefSeq Size 4394 bp
RefSeq ORF 954 bp
Locus ID 67588
UniProt ID Q8BH75
Gene Summary Acts as E3 ubiquitin-protein ligase and regulates the degradation of target proteins. Polyubiquitinates MYD88 (By similarity). Negatively regulates MYD88-dependent production of proinflammatory cytokines. Can promote TRIF-dependent production of type I interferon and inhibits infection with vesicular stomatitis virus. Promotes also activation of TBK1 and IRF3 (PubMed:19483718). Involved in the ubiquitination of erythropoietin (EPO) and interleukin-3 (IL-3) receptors. Thus, through maintaining basal levels of cytokine receptors, RNF41 is involved in the control of hematopoietic progenitor cell differentiation into myeloerythroid lineages (PubMed:18495327). Contributes to the maintenance of steady-state ERBB3 levels by mediating its growth factor-independent degradation. Involved in the degradation of the inhibitor of apoptosis BIRC6 and thus is an important regulator of cell death by promoting apoptosis. Acts also as a PRKN modifier that accelerates its degradation, resulting in a reduction of PRKN activity, influencing the balance of intracellular redox state. The RNF41-PRKN pathway regulates autophagosome-lysosome fusion during late mitophagy. Mitophagy is a selective form of autophagy necessary for mitochondrial quality control (PubMed:24949970).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript which encodes a functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...