Gemin2 (NM_025656) Mouse Untagged Clone

CAT#: MC210401

Gemin2 (untagged) - Mouse survival of motor neuron protein interacting protein 1 (Sip1), (10ug)



  "NM_025656" in other vectors (4)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Sip1 Antibody
    • 50 ug

CN¥ 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms gemin-2; S; Sip1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210401 representing NM_025656
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTGGGTTCCAGCCGAGTCTGCGGTGGAAGAGTTGATGCCACGGTTGTTACCTGTGGAGCCCTGTG
ACTTGACGGAAGGTTTCGATCCCTCGGTCCCCCCCAGGACGCCTCAGGAATATCTGAGGAGAGTGCAGAT
CGAAGCAGCCCAATGTCCAGATGTTGTGGTAGCCCAGATTGACCCAAAGAAGTTGAAAAGGAAGCAAAGT
GTGAACATTTCTCTTTCCGGATGCCAGCCTGCGCCTGAAGGTTACTCTCCAACACTTCAGTGGCAACAAC
AACAAGTGGCACATTTTTCAACTGTTCGACAGAGTGTACACAAGCATAGAAATCACTGGAAATCACAACA
GTTGGACAGTAATGTGGCAATGCCAAAATCTGAAGATGAAGAAGGCTGGAAAAAATTTTGTCTGGGTGAA
AGGTTATGTGCTGAAGGGGCCACTGGACCGTCTACAGAGGAAAGCCCTGGGATCGATTATGTACAAGTTG
GTTTTCCTCCTTTGCTTAGTATTGTAAGCAGAATGAATCAGACAACCATTACTAGTGTCTTGGAATATCT
AAGTAATTGGTTTGGAGAAAGAGACTTTACTCCAGAATTGGGAAGATGGTTTTATGCTTTGTTGGCTTGT
CTTGAAAAGCCTTTATTACCTGAGGCTCATTCACTAATCCGACAGCTTGCAAGAAGATGTTCTGAAGTGA
GGCTGCTGGTGGGCAGTAAAGATGACGAAAGAGTCCCAGCTTTGAATCTGCTGATCTGCTTAGTTAGCAG
GTATTTTGATCAACGCGATTTAGCTGATGAGCCATCTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025656
Insert Size 810 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_025656.5, NP_079932.2
RefSeq Size 1590 bp
RefSeq ORF 810 bp
Locus ID 66603
UniProt ID Q9CQQ4
Gene Summary This gene encodes one of the proteins found in the survival of motor neuron (SMN) complex, which consists of the SMN protein and several gemin proteins. The SMN complex is localized to a subnuclear compartment called gems (gemini of coiled bodies) and is required for assembly of spliceosomal small nuclear ribonucleoproteins (snRNP) and for pre-mRNA splicing. This protein interacts directly with the SMN protein and it is required for formation of the SMN complex. Disruption of this gene in mouse resulted in impaired snRNP assembly, and motor neuron degeneration. [provided by RefSeq, Sep 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...