Bud23 (NM_025375) Mouse Untagged Clone

CAT#: MC210281

Wbscr22 (untagged) - Mouse Williams Beuren syndrome chromosome region 22 (Wbscr22), (10ug)



  "NM_025375" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1110003N24Rik; Wbscr22
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210281 representing NM_025375
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCATCTCGTAGCCGGAGACCCGAACACAGCGGACCGCCGGAGCTGTTTTATGACCAGAATGAAGCCC
GGAAATACGTTCGCAACTCACGGATGATTGACATCCAGACCAAGATGACTGAGCGAGCGCTGGAGCTCCT
CTGTTTACCAGAGGGTCAGCCTTCTTACCTGTTAGACATTGGCTGCGGTTCTGGGCTGAGTGGAGATTAT
ATCTCAGAAGAGGGACACTACTGGGTGGGCATTGACATCAGCCCTGCCATGTTGGATGCCGCCTTGGACC
GAGATACAGAGGGGGACCTGCTGCTAGGGGACATGGGCCAGGGCGTCCCTTTCAGACCGGGCTCTTTTGA
TGGCTGCATCAGCATCTCTGCTGTGCAGTGGCTCTGCAACGCCAACAAGAAGTCGGACGTCCCTGCCAGG
CGCCTGTACTGCTTCTTTTCTTCCTTGTACTCTGCCCTTGTCCGTGGGGCCCGAGCTGTCCTGCAGCTGT
ACCCTGAGAACTCGGAGCAGCTGGAGCTGATCACAACCCAGGCCACGAGGGCAGGCTTCACTGGCGGCGT
GGTGGTAGACTTCCCCAACAGTGCCAAAGCAAAGAAGTTCTACCTCTGTCTGTTTTCTGGGCCTTCCACC
TCCCTGCCAAAGGGGCTGACTGAAAGTCAGGATGCAGACCAGGCCTCCGAGTCCATGTTCACCAGTGAGC
GGGCCCCACACAAGAAGGCACGGAGGGACCTGGTGAAGAAGAGCCGGGAATGGGTCCTAGAGAAGAAGGA
GAGGCGCAGGCGCCAGGGCAAGGAGGTCAGACCTGACACCCAGTACACCGGCCGAAAGCGCAAGCCCCGC
TTCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_025375
Insert Size 846 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_025375.3, NP_079651.2
RefSeq Size 1531 bp
RefSeq ORF 846 bp
Locus ID 66138
UniProt ID Q9CY21
Gene Summary S-adenosyl-L-methionine-dependent methyltransferase that specifically methylates the N(7) position of a guanine in 18S rRNA. Requires the methyltransferase adapter protein TRM112 for full rRNA methyltransferase activity. Involved in the pre-rRNA processing steps leading to small-subunit rRNA production independently of its RNA-modifying catalytic activity. Important for biogenesis end export of the 40S ribosomal subunit independent on its methyltransferase activity. Locus-specific steroid receptor coactivator. Potentiates transactivation by glucocorticoid (NR3C1), mineralocorticoid (NR3C2), androgen (AR) and progesterone (PGR) receptors. Required for the maintenance of open chromatin at the TSC22D3/GILZ locus to facilitate NR3C1 loading on the response elements. Required for maintenance of dimethylation on histone H3 'Lys-79' (H3K79me2), although direct histone methyltransferase activity is not observed in vitro.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...