Il21 (NM_021782) Mouse Untagged Clone

CAT#: MC210208

Il21 (untagged) - Mouse interleukin 21 (Il21), (10ug)



  "NM_021782" in other vectors (4)

CN¥ 1,200.00

CN¥ 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms IL-21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210208 representing NM_021782
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGAGGACCCTTGTCTGTCTGGTAGTCATCTTCTTGGGGACAGTGGCCCATAAATCAAGCCCCCAAG
GGCCAGATCGCCTCCTGATTAGACTTCGTCACCTTATTGACATTGTTGAACAGCTGAAAATCTATGAAAA
TGACTTGGATCCTGAACTTCTATCAGCTCCACAAGATGTAAAGGGGCACTGTGAGCATGCAGCTTTTGCC
TGTTTTCAGAAGGCCAAACTCAAGCCATCAAACCCTGGAAACAATAAGACATTCATCATCGACCTCGTGG
CCCAGCTGAGGAGGAGGCTGCCTGCCAGGAGGGGAGGAAAGAAACAGAAGCACATAGCTAAATGCCCTTC
CTGTGATTCGTATGAGAAAAGAACACCCAAAGAATTCCTAGAAAGACTAAAATGGCTCCTTCAAAAGATG
ATTCATCAGCATCTCTCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_021782
Insert Size 441 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC125414, AAI25415
RefSeq Size 2421 bp
RefSeq ORF 441 bp
Locus ID 60505
UniProt ID Q9ES17
Gene Summary Cytokine with immunoregulatory activity. May promote the transition between innate and adaptive immunity. Induces the production of IgG(1) and IgG(3) in B-cells. May play a role in proliferation and maturation of natural killer (NK) cells in synergy with IL15. May regulate proliferation of mature B- and T-cells in response to activating stimuli. In synergy with IL15 and IL18 stimulates interferon gamma production in T-cells and NK cells (By similarity). During T-cell mediated immune response may inhibit dendritic cells (DC) activation and maturation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks a segment in the 3' coding region which results in a frameshift compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...