United States
Germany
Japan
United Kingdom
China
Lat2 (NM_020044) Mouse Untagged Clone
CAT＃: MC210091
Lat2 (untagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 1, (10ug)
CN¥ 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AW125574; LAB; NTAL; Wbscr5; Wbscr15; WSCR5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC210091 representing NM_020044
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGTGCCGAGCTGGAGCTGCTGTGGCCGGTGTCGGGATTATTGCTGCTGCTGTTGGGGGCCACAGCCT GGCTGTGTGTCCACTGCTCCCGTCCAGGAGTGAAGAGAAATGAGAAAATCTACGAGCAGAGGAACCGGCA AGAAAATGCACAGAGCTCAGCTGCGGCTCAGACATACTCCCTGGCCAGGCAGGTGTGGCCAGGACCCCAG ATGGACACAGCTCCAAACAAGTCATTTGAAAGGAAGAACAAGATGCTGTTCTCCCACCTTGAGGGTCCTG AGTCCCCTAGGTACCAGAACTTCTACAAAGGAAGTAACCAGGAGCCTGATGCTGCCTATGTAGACCCCAT CCCTACAAACTACTACAACTGGGGATGTTTCCAGAAGCCCTCAGAAGACGACGATTCCAACTCCTACGAG AATGTGCTCGTCTGCAAGCCCAGCACCCCCGAGTCAGGTGTCGAGGACTTTGAGGATTACCAGAACTCAG TATCCATCCATCAGTGGCGAGAGTCCAAGAGGACTATGGGTGCACCAATGTCCCTATCAGGAAGCCCAGA TGAGGAGCCAGACTATGTGAATGGGGATGTGGCCGCAGCAGAGAACATCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_020044 |
| Insert Size | 612 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_020044.3, NP_064428.1 |
| RefSeq Size | 1672 bp |
| RefSeq ORF | 612 bp |
| Locus ID | 56743 |
| UniProt ID | Q9JHL0 |
| Gene Summary | Involved in FCER1 (high affinity immunoglobulin epsilon receptor)-mediated signaling in mast cells. May also be involved in BCR (B-cell antigen receptor)-mediated signaling in B-cells and FCGR1 (high affinity immunoglobulin gamma Fc receptor I)-mediated signaling in myeloid cells. Couples activation of these receptors and their associated kinases with distal intracellular events through the recruitment of GRB2.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227247 | Lat2 (tGFP-tagged) - Mouse linker for activation of T cells family member 2 (Lat2) transcript variant 1, (10ug) |
CN¥ 5,440.00 |
|
| MR227247 | Lat2 (Myc-DDK-tagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 1 |
CN¥ 2,000.00 |
|
| MR227247L3 | Lenti ORF clone of Lat2 (Myc-DDK-tagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 1 |
CN¥ 3,900.00 |
|
| MR227247L4 | Lenti ORF clone of Lat2 (mGFP-tagged) - Mouse linker for activation of T cells family, member 2 (Lat2), transcript variant 1 |
CN¥ 3,900.00 |
