Cldn18 (NM_001194922) Mouse Untagged Clone

CAT#: MC210062

Cldn18 (untagged) - Mouse claudin 18 (Cldn18), transcript variant A1.2, (10ug)



  "NM_001194922" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210062 representing NM_001194922
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCACCACCACGTGCCAGGTGGTAGGGCTTCTCCTGTCCCTCCTGGGTCTGGCCGGCTGCATAGCCG
CCACTGGGATGGACATGTGGAGCACTCAAGACCTGTATGACAACCCAGTCACCGCCGTGTTCCAGTATGA
AGGGCTCTGGAGGAGTTGCGTGCAACAGAGCTCGGGGTTCACCGAGTGCCGGCCATACTTCACCATCCTG
GGCCTTCCAGCCATGCTGCAAGCTGTACGAGCCCTGATGATCGTGGGCATTGTTCTGGGGGTCATCGGTA
TCCTCGTGTCCATCTTCGCCCTGAAGTGCATTCGCATTGGTAGCATGGATGACTCTGCCAAGGCCAAGAT
GACTCTGACTTCTGGGATCTTGTTCATCATCTCCGGCATCTGTGCAATCATTGGTGTGTCTGTGTTTGCC
AACATGCTGGTGACCAACTTCTGGATGTCCACAGCTAACATGTACAGCGGCATGGGCGGCATGGGTGGCA
TGGTGCAGACCGTTCAGACCAGGTACACCTTTGGTGCAGCTCTGTTCGTGGGCTGGGTTGCTGGAGGCCT
CACCCTGATTGGGGGAGTGATGATGTGCATCGCCTGCCGTGGCCTGACACCAGATGACAGCAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001194922
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001194922.1, NP_001181851.1
RefSeq Size 2849 bp
RefSeq ORF 627 bp
Locus ID 56492
UniProt ID P56857
Gene Summary This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This gene is a downstream target gene regulated by the T/EBP/NKX2.1 homeodomain transcription factor. Four alternatively spliced transcript variants resulted from alternative promoters and alternative splicing have been identified, which encode two lung-specific isoforms and two stomach-specific isoforms respectively. This gene is also expressed in colons, inner ear and skin, and its expression is increased in both experimental colitis and ulcerative colitis. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (A1.2) is the lung-specific form. It has an additional segment in the CDS, which results in an immediate translation termination, as compared to variant A1.1. The resulting isoform (A1.2) is C-terminal truncated, as compared to isoform A1.1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...