Espn (NM_019585) Mouse Untagged Clone
CAT#: MC210031
Espn (untagged) - Mouse espin (Espn), transcript variant 6, (10ug)
CNY 2,400.00
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | je |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC210031 representing NM_019585
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACTCCCAGGGGCCTCTAGGTGGGGGCCATATACCCAGCACCAAATCTTTCAACATGATGTCCCCAA CGGGTGATAACTCAGAGCTTCTGGCTGAGATAAAGGCGGGCAAGAGCCTGAAGCCGACACCGCAGAGCAA GGGGCTGACAACCGTGTTCTCAGGCAGTGGGCAGCCAGCCTCCCAGGTAGGCACTGGCCGAGTGCCCCGC CCGGGCTCCCAGTGCCTGCCCAGTGCTCAGCCCTACTGCTTCTCCCGGCAGCCTGAGTCACCGCAGCCTC TGGTGTCACCTGCGCCATCTCGGACTCGGAGCCCCACCCCGCCAGCCTCTGGGTCTCAGCCACTGCTCAA TGGCAGTGTGGTGCCGGCACCACCTGCCACCCCGGCACCTGGAGTCCATCTGGATGTGGAGGCCCTCATT CCCACTCTTGATGAGCAGGGCCGGCCCATCCCGGAGTGGAAGCGCCAGGTGATGGTCCGCAAGCTGCAGC AGAAGATGCAGGAGGAAGAGGAGCAGCGGAGGAAGGAGGAAGAGGAGGAGGCCCGGCTCGCCAGCCTGCC TGCCTGGAGACGAGACATTCTTCGGAAGAAGCTGGAGGAGGAGAGGGAGCAGAAGCGAAAAGAGGAGGAG CGGCAAAAGCTGGAGGAAATACAGAGGGCGAAAGAACAGTCGGAGAAGCTGCGGACACTAGGCTACGACG AAGCCAAGCTCGCGCCCTGGCAGCGACAGGTCATCTTGAAGAAGGGGGAGATCCCTAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019585 |
Insert Size | 762 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_019585.3, NP_062531.2 |
RefSeq Size | 1123 bp |
RefSeq ORF | 762 bp |
Locus ID | 56226 |
Gene Summary | Multifunctional actin-bundling protein. Plays a major role in regulating the organization, dimension, dynamics and signaling capacities of the actin filament-rich microvilli in the mechanosensory and chemosensory cells (PubMed:14657236, PubMed:15190118). Required for the assembly and stabilization of the stereociliary parallel actin bundles. Plays a crucial role in the formation and maintenance of inner ear hair cell stereocilia (PubMed:21455486). Involved in the elongation of actin in stereocilia (PubMed:19287378, PubMed:22264607). In extrastriolar hair cells, required for targeting MYO3B to stereocilia tips, and for regulation of stereocilia diameter and staircase formation (PubMed:26926603).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (6) has multiple differences in the coding region but maintains the reading frame, compared to variant 1. This variant encodes isoform 6 which is shorter than isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
A naturally monomeric infrared fluorescent protein for protein labeling in vivo
,Yu, D;Baird, MA;Allen, JR;Howe, ES;Klassen, MP;Reade, A;Makhijani, K;Song, Y;Liu, S;Murthy, Z;Zhang, SQ;Weiner, OD;Kornberg, TB;Jan, YN;Davidson, MW;Shu, X;,
Nat. Methods
,PubMed ID 26098020
[ESPN]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224961 | Espn (tGFP-tagged) - Mouse espin (Espn) transcript variant 6, (10ug) |
CNY 2,850.00 |
|
MR224961 | Espn (Myc-DDK-tagged) - Mouse espin (Espn), transcript variant 6 |
CNY 2,570.00 |
|
MR224961L3 | Lenti ORF clone of Espn (Myc-DDK-tagged) - Mouse espin (Espn), transcript variant 6 |
CNY 4,470.00 |
|
MR224961L4 | Lenti ORF clone of Espn (mGFP-tagged) - Mouse espin (Espn), transcript variant 6 |
CNY 4,470.00 |