Prok2 (NM_001037539) Mouse Untagged Clone
CAT#: MC209850
Prok2 (untagged) - Mouse prokineticin 2 (Prok2), transcript variant 2, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Bv8; PK2; Prok1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209850 representing NM_001037539
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGGGACCCGCGCTGTGCCCCGCTACTGCTACTTCTGCTGCTACCGCTGCTGTTCACACCGCCCGCCG GGGATGCCGCGGTCATCACCGGGGCTTGCGACAAGGACTCTCAGTGCGGAGGAGGCATGTGCTGTGCTGT CAGTATCTGGGTTAAGAGCATAAGGATCTGCACACCTATGGGCCAAGTGGGCGACAGCTGCCACCCCCTG ACTCGGAAAGTTCCATTTTGGGGGCGGAGGATGCACCACACCTGCCCCTGCCTGCCAGGCTTGGCGTGTT TAAGGACTTCTTTCAACCGGTTTATTTGCTTGGCCCGGAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037539 |
Insert Size | 324 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001037539.2, NP_001032628.1 |
RefSeq Size | 1450 bp |
RefSeq ORF | 324 bp |
Locus ID | 50501 |
UniProt ID | Q9QXU7 |
Gene Summary | May function as an output molecule from the suprachiasmatic nucleus (SCN) that transmits behavioral circadian rhythm. May also function locally within the SCN to synchronize output. Potently contracts gastrointestinal (GI) smooth muscle (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG218543 | Prok2 (tGFP-tagged) - Mouse prokineticin 2 (Prok2) transcript variant 2, (10ug) |
CNY 4,370.00 |
|
MR218543 | Prok2 (Myc-DDK-tagged) - Mouse prokineticin 2 (Prok2), transcript variant 2 |
CNY 1,920.00 |
|
MR218543L3 | Lenti ORF clone of Prok2 (Myc-DDK-tagged) - Mouse prokineticin 2 (Prok2), transcript variant 2 |
CNY 5,890.00 |
|
MR218543L4 | Lenti ORF clone of Prok2 (mGFP-tagged) - Mouse prokineticin 2 (Prok2), transcript variant 2 |
CNY 5,890.00 |