Cabp1 (NM_013879) Mouse Untagged Clone

CAT#: MC209829

Cabp1 (untagged) - Mouse calcium binding protein 1 (Cabp1), (10ug)



  "NM_013879" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms caldendrin
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209829 representing NM_013879
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCAACTGCGTCAAGTCGCCACTAAGAAACCTCTCAAGAAAGATGCGCCAGGAGGAGAAGACCAGCT
ACATGGCGGTGCAGACAAGCGAGGACGGGCTGGCGGATGGCGGCGAGCTCCATGGACCACTCATGATGCT
GGCCCAGAACTGTGCGGTCATGCACAACCTGCTGGGTCCCGCCTGCATTTTTCTCCGAAAGGGTTTTGCT
GAGAACAGACAACCTGACAGATCGTTACGACCAGAGGAGATTGAAGAGCTCCGAGAGGCCTTCCGAGAAT
TTGACAAAGACAAGGATGGTTACATCAACTGCCGGGACCTGGGGAACTGCATGCGCACCATGGGCTACAT
GCCCACCGAGATGGAGCTCATTGAGCTGTCTCAGCAGATCAACATGAACCTGGGTGGCCACGTGGATTTT
GATGACTTTGTGGAACTGATGGGCCCTAAACTCCTGGCGGAGACGGCAGATATGATTGGTGTAAAGGAGC
TGAGAGACGCCTTTCGGGAGTTTGATACCAACGGTGACGGGGAGATAAGTACGAGCGAGCTTCGAGAGGC
CATGAGGAAGCTCCTGGGTCATCAGGTGGGACACCGGGACATAGAGGAAATTATCCGAGACGTGGACCTC
AATGGAGATGGACGAGTGGACTTTGAAGAGTTTGTCCGGATGATGTCTCGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_013879
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013879.2, NP_038907.1
RefSeq Size 1181 bp
RefSeq ORF 684 bp
Locus ID 29867
UniProt ID Q9JLK7
Gene Summary Modulates calcium-dependent activity of inositol 1,4,5-triphosphate receptors (ITPRs). Inhibits agonist-induced intracellular calcium signaling. Enhances inactivation and does not support calcium-dependent facilitation of voltage-dependent P/Q-type calcium channels (By similarity). Causes calcium-dependent facilitation and inhibits inactivation of L-type calcium channels by binding to the same sites as calmodulin in the C-terminal domain of CACNA1C, but has an opposite effect on channel function. Suppresses the calcium-dependent inactivation of CACNA1D (PubMed:17050707, PubMed:17947313). Inhibits TRPC5 channels. Prevents NMDA receptor-induced cellular degeneration (By similarity). Required for the normal transfer of light signals through the retina (PubMed:27822497).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region compared to variant 1. The encoded isoform (2) has a distinct N-terminus and is shorter than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...