Cops5 (NM_013715) Mouse Untagged Clone
CAT#: MC209743
Cops5 (untagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI303502; CSN5; Jab1; Mov34; Sgn5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209743 representing NM_013715
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAGCTTCCGGGAGTGGTATGGCCCAGAAAACCTGGGAATTGGCCAACAACATGCAGGAAGCGCAGA GTATCGATGAAATCTACAAATATGACAAAAAACAACAACAAGAAATCCTGGCGGCGAAACCCTGGACTAA GGATCACCACTACTTTAAATACTGCAAAATCTCAGCATTGGCTCTACTGAAAATGGTGATGCATGCCAGG TCAGGAGGCAACTTGGAAGTGATGGGTTTGATGCTCGGGAAAGTCGACGGCGAGACCATGATCATCATGG ACAGTTTCGCTTTGCCTGTAGAGGGCACAGAAACTCGAGTAAATGCTCAAGCTGCTGCGTATGAGTATAT GGCTGCATACATAGAAAATGCCAAACAGGTTGGCCGCCTTGAGAATGCAATCGGTTGGTATCATAGCCAC CCTGGTTATGGCTGCTGGCTCTCCGGGATTGATGTTAGTACACAGATGCTGAACCAGCAGTTTCAAGAAC CATTTGTAGCAGTGGTGATTGATCCAACCAGAACAATCTCTGCAGGAAAAGTGAATCTTGGCGCCTTTAG GACATATCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCAGACTATCCCACTTAATAAA ATAGAAGATTTTGGCGTGCACTGCAAACAATATTATGCCTTAGAAGTCTCATATTTCAAATCATCTTTGG ATCGTAAACTACTTGAGCTTTTGTGGAATAAATACTGGGTGAATACCCTGAGTTCCTCTAGCTTGCTTAC TAATGCAGACTACACCACAGGCCAGGTGTTTGATTTGTCTGAGAAGTTAGAGCAGTCGGAAGCCCAACTG GGACGTGGCAGTTTCATGTTGGGCTTAGAAACACATGACCGCAAGTCGGAAGACAAACTTGCCAAAGCTA CTAGAGACAGCTGTAAAACCACCATAGAAGCCATCCATGGACTGATGTCTCAGGTTATTAAGGATAAACT GTTTAATCAGATTAACGTTGCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_013715 |
Insert Size | 1005 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_013715.2, NP_038743.1 |
RefSeq Size | 1731 bp |
RefSeq ORF | 1005 bp |
Locus ID | 26754 |
UniProt ID | O35864 |
Gene Summary | Probable protease subunit of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of the SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. Promotes the proteasomal degradation of BRSK2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. In the complex, it probably acts as the catalytic center that mediates the cleavage of Nedd8 from cullins. It however has no metalloprotease activity by itself and requires the other subunits of the CSN complex. Interacts directly with a large number of proteins that are regulated by the CSN complex, confirming a key role in the complex.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204941 | Cops5 (tGFP-tagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5) |
CNY 4,370.00 |
|
MR204941 | Cops5 (Myc-DDK-tagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5) |
CNY 5,488.00 |
|
MR204941L3 | Lenti ORF clone of Cops5 (Myc-DDK-tagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5) |
CNY 5,890.00 |
|
MR204941L4 | Lenti ORF clone of Cops5 (mGFP-tagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5) |
CNY 5,890.00 |