Cops5 (NM_013715) Mouse Untagged Clone

CAT#: MC209743

Cops5 (untagged) - Mouse COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) (Cops5), (10ug)



  "NM_013715" in other vectors (4)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI303502; CSN5; Jab1; Mov34; Sgn5
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209743 representing NM_013715
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGCTTCCGGGAGTGGTATGGCCCAGAAAACCTGGGAATTGGCCAACAACATGCAGGAAGCGCAGA
GTATCGATGAAATCTACAAATATGACAAAAAACAACAACAAGAAATCCTGGCGGCGAAACCCTGGACTAA
GGATCACCACTACTTTAAATACTGCAAAATCTCAGCATTGGCTCTACTGAAAATGGTGATGCATGCCAGG
TCAGGAGGCAACTTGGAAGTGATGGGTTTGATGCTCGGGAAAGTCGACGGCGAGACCATGATCATCATGG
ACAGTTTCGCTTTGCCTGTAGAGGGCACAGAAACTCGAGTAAATGCTCAAGCTGCTGCGTATGAGTATAT
GGCTGCATACATAGAAAATGCCAAACAGGTTGGCCGCCTTGAGAATGCAATCGGTTGGTATCATAGCCAC
CCTGGTTATGGCTGCTGGCTCTCCGGGATTGATGTTAGTACACAGATGCTGAACCAGCAGTTTCAAGAAC
CATTTGTAGCAGTGGTGATTGATCCAACCAGAACAATCTCTGCAGGAAAAGTGAATCTTGGCGCCTTTAG
GACATATCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCAGACTATCCCACTTAATAAA
ATAGAAGATTTTGGCGTGCACTGCAAACAATATTATGCCTTAGAAGTCTCATATTTCAAATCATCTTTGG
ATCGTAAACTACTTGAGCTTTTGTGGAATAAATACTGGGTGAATACCCTGAGTTCCTCTAGCTTGCTTAC
TAATGCAGACTACACCACAGGCCAGGTGTTTGATTTGTCTGAGAAGTTAGAGCAGTCGGAAGCCCAACTG
GGACGTGGCAGTTTCATGTTGGGCTTAGAAACACATGACCGCAAGTCGGAAGACAAACTTGCCAAAGCTA
CTAGAGACAGCTGTAAAACCACCATAGAAGCCATCCATGGACTGATGTCTCAGGTTATTAAGGATAAACT
GTTTAATCAGATTAACGTTGCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_013715
Insert Size 1005 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013715.2, NP_038743.1
RefSeq Size 1731 bp
RefSeq ORF 1005 bp
Locus ID 26754
UniProt ID O35864
Gene Summary Probable protease subunit of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of the SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. Promotes the proteasomal degradation of BRSK2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. In the complex, it probably acts as the catalytic center that mediates the cleavage of Nedd8 from cullins. It however has no metalloprotease activity by itself and requires the other subunits of the CSN complex. Interacts directly with a large number of proteins that are regulated by the CSN complex, confirming a key role in the complex.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...