Vip (NM_011702) Mouse Untagged Clone
CAT#: MC209641
Vip (untagged) - Mouse vasoactive intestinal polypeptide (Vip), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209641 representing NM_011702
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAAGCCAGAAGCAAGCCTCAGTTCCTGGCATTCCTGATACTCTTCAGTGTGCTGTTCTCTCAGTCGC TGGCCTGGCCTCTCTTTGGACCACCTTCTGTAGTGAGTAGGCTGGATGACAGGATGCCGTTTGAAGGAGC AGGTGACCCTGACCAAGTCTCTTTAAAAGCAGACTCTGACATCTTGCAGAATCCCTTAGCAGAAAATGGC ACACCCTATTATGATGTGTCAAGAAATGCCAGGCATGCTGATGGAGTTTTCACCAGCGATTACAGCAGAC TTCTGGGTCAGATTTCTGCCAAAAAATACCTTGAGTCACTCATTGGCAAACGAATCAGCAGCAGCATCTC GGAAGATCCTGTGCCAATCAAACGACACTCTGATGCCGTCTTCACAGATAACTACACCCGCCTCAGAAAG CAAATGGCTGTGAAGAAATACCTGAACTCCATCCTGAATGGAAAGAGGAGCAGTGAGGGAGATTCTGCAG ACTTTCTTGAAGAGCTGGAGAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011702 |
Insert Size | 516 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC089511, AAH89511 |
RefSeq Size | 1466 bp |
RefSeq ORF | 516 bp |
Locus ID | 22353 |
UniProt ID | P32648 |
Gene Summary | This gene encodes a neuropeptide of the glucagon/secretin superfamily with potent bronchodilator, immunomodulator and anti-inflammatory properties. The encoded protein is proteolytically processed to generate two structurally similar neuropeptides - vasoactive intestinal peptide (VIP) and peptide histidine isoleucine (PHI). In the digestive tract, VIP stimulates relaxation of enteric smooth muscle, secretion of water and electrolytes, release of insulin and glucagon, and inhibition of gastric acid secretion. In the cardiovascular system, VIP causes coronary vasodilation and stimulates contractility in the heart. Mice lacking VIP exhibit airway hyperresponsiveness and airway inflammation. Male mice lacking VIP exhibit moderate pulmonary arterial hypertension resulting in increased mortality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226907 | Vip (tGFP-tagged) - Mouse vasoactive intestinal polypeptide (Vip), (10ug) |
CNY 2,850.00 |
|
MR226907 | Vip (Myc-DDK-tagged) - Mouse vasoactive intestinal polypeptide (Vip) |
CNY 2,400.00 |
|
MR226907L3 | Lenti ORF clone of Vip (Myc-DDK-tagged) - Mouse vasoactive intestinal polypeptide (Vip) |
CNY 4,750.00 |
|
MR226907L4 | Lenti ORF clone of Vip (mGFP-tagged) - Mouse vasoactive intestinal polypeptide (Vip) |
CNY 4,750.00 |