Trp63 (NM_001127263) Mouse Untagged Clone

CAT#: MC209588

Trp63 (untagged) - Mouse transformation related protein 63 (Trp63), transcript variant 7, (10ug)



  "NM_001127263" in other vectors (3)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Trp63 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI462811; delta; Ket; p6; p7; p51/p; P51/P63; P63; P73l; TAp; Tp63; Trp5; Trp53rp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209588 representing NM_001127263
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTGTACCTGGAAAACAATGCCCAGACTCAATTTAGTGAGCCACAGTACACGAACCTGGGGCTCCTGA
ACAGCATGGACCAGCAGATTCAGAACGGCTCCTCGTCCACCAGCCCCTACAACACAGACCACGCACAGAA
TAGCGTGACGGCGCCCTCGCCCTATGCACAGCCCAGCTCCACCTTTGATGCCCTCTCTCCATCCCCTGCC
ATTCCCTCCAACACAGATTACCCGGGCCCACACAGCTTCGATGTGTCCTTCCAGCAGTCAAGCACTGCCA
AGTCAGCCACCTGGACGTATTCCACCGAACTGAAGAAGCTGTACTGCCAGATTGCGAAGACATGCCCCAT
CCAGATCAAGGTGATGACCCCACCCCCACAGGGCGCTGTTATCCGTGCCATGCCTGTCTACAAGAAAGCT
GAGCATGTCACCGAGGTTGTGAAACGATGCCCTAACCATGAGCTGAGCCGTGAGTTCAATGAGGGACAGA
TTGCCCCTCCCAGTCATCTGATTCGAGTAGAAGGGAACAGCCATGCCCAGTATGTAGAAGATCCTATCAC
GGGAAGGCAGAGCGTGCTGGTCCCTTATGAGCCACCACAGGTTGGCACTGAATTCACAACAGTCCTGTAC
AATTTCATGTGTAACAGCAGCTGCGTCGGAGGAATGAACAGACGTCCAATTTTAATCATCGTTACTCTGG
AAACCAGAGATGGGCAAGTCCTGGGCCGACGGTGCTTTGAGGCCCGGATCTGTGCTTGCCCAGGAAGAGA
CCGGAAGGCAGATGAAGACAGCATCAGAAAGCAGCAAGTATCGGACAGCGCAAAGAACGGCGATGGTACG
AAGCGCCCTTTCCGTCAGAATACACACGGAATCCAGATGACTTCCATCAAGAAACGGAGATCCCCAGATG
ATGAGCTGCTGTACCTACCAGTGAGAGGTCGTGAGACGTACGAGATGTTGCTGAAGATCAAAGAGTCACT
GGAGCTCATGCAGTACCTCCCTCAGCACACGATCGAAACGTACAGGCAGCAGCAGCAGCAGCAGCACCAG
CACCTACTTCAGAAACATCTCCTTTCAGCCTGCTTCAGGAATGAGCTTGTGGAGCCCCGGGGAGAAGCTC
CGACACAGTCTGACGTCTTCTTTAGACATTCCAACCCCCCAAACCACTCCGTGTACCCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001127263
Insert Size 1182 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127263.1, NP_001120735.1
RefSeq Size 1729 bp
RefSeq ORF 1182 bp
Locus ID 22061
Gene Summary This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
Transcript Variant: This variant (7) is an alternate promoter product; it lacks several 5' and 3' exons, but has alternate 5' and 3' exons, as compared to variant 1. The resulting isoform (g, also known as DNp63gamma) has shorter and different N- and C-termini, as compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...