United States
Germany
Japan
United Kingdom
China
Tcf7 (NM_009331) Mouse Untagged Clone
CAT＃: MC209498
Tcf7 (untagged) - Mouse transcription factor 7, T-cell specific (Tcf7), (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AI465550; TCF-1; Tcf1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209498 representing NM_009331
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTACAAAGAGACTGTCTACTCTGCCTTCAATCTGCTCATGCCCTACCCACCGGCCTCGGGAGCAGGGC AGCATCCGCAGCCTCAACCCCCGCTGCATAACAAGCCCGGCCAGCCTCCACATGGCGTCCCCCAGCTTTC TCCACTCTACGAACATTTCAGCAGTCCACACCCCACCCCTGCACCAGCGGACATCAGCCAGAAGCAAGGA GTTCACAGGCCGCTGCAGACCCCCGATCTCTCTGGATTTTATTCTCTGACCTCAGGCAGCATGGGACAGC TCCCCCATACTGTGAGCTGGCCCAGTCCTCCTCTCTACCCCCTGTCCCCTTCCTGCGGATATAGACAGCA CTTCCCTGCCCCCACTGCAGCCCCTGGCGCCCCCTATCCCAGGTTCACCCACCCATCCTTGATGCTGGGA TCTGGTGTACCTGGACACCCAGCAGCCATCCCTCACCCGGCCATTGTGCCCTCCTCAGGGAAGCAGGAGC TGCAGCCATATGATAGAAACCTGAAAACACAGGCAGAACCCAAGGCAGAGAAGGAGGCTAAGAAGCCAGT CATCAAGAAACCCCTCAATGCGTTCATGCTTTACATGAAGGAGATGAGAGCCAAGGTCATTGCTGAGTGC ACACTCAAGGAGAGCGCTGCCATCAACCAGATCCTGGGTCGCAGGTGGCATGCACTATCTCGAGAAGAGC AGGCCAAGTACTATGAACTGGCCCGCAAGGAAAGGCAGCTGCACATGCAGCTATACCCGGGCTGGTCCGC GCGGGATAACTACGGAAAGAAGAAGAGGCGGTCAAGGGAAAAACATCAAGAATCCACCACAGGAGGAAAA AGAAATGCATTCGGTACTTACCCGGAGAAGGCCGCTGCCCCAGCCCCGTTCCTTCCGATGACAGTGCTCT AG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_009331 |
| Insert Size | 912 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC138596, AAI38597 |
| RefSeq Size | 1704 bp |
| RefSeq ORF | 912 bp |
| Locus ID | 21414 |
| UniProt ID | Q00417 |
| Gene Summary | This gene encodes a transcription factor which is a member of the T-cell specific transcription factor family. The encoded protein is distinct from the hepatic transcription factor, transcription factor 1, which is also referred to by the symbol Tcf1. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226713 | Tcf7 (tGFP-tagged) - Mouse transcription factor 7 T-cell specific (Tcf7), (10ug) |
CNY 4,370.00 |
|
| MR226713 | Tcf7 (Myc-DDK-tagged) - Mouse transcription factor 7, T-cell specific (Tcf7) |
CNY 2,400.00 |
|
| MR226713L1 | Lenti ORF clone of Tcf7 (Myc-DDK-tagged) - Mouse transcription factor 7, T-cell specific (Tcf7) |
CNY 4,800.00 |
|
| MR226713L2 | Lenti ORF clone of Tcf7 (mGFP-tagged) - Mouse transcription factor 7, T-cell specific (Tcf7) |
CNY 4,800.00 |
|
| MR226713L3 | Lenti ORF clone of Tcf7 (Myc-DDK-tagged) - Mouse transcription factor 7, T-cell specific (Tcf7) |
CNY 5,890.00 |
|
| MR226713L4 | Lenti ORF clone of Tcf7 (mGFP-tagged) - Mouse transcription factor 7, T-cell specific (Tcf7) |
CNY 4,800.00 |
