Strap (NM_011499) Mouse Untagged Clone

CAT#: MC209478

Strap (untagged) - Mouse serine/threonine kinase receptor associated protein (Strap), (10ug)



  "NM_011499" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
STRAP Antibody - middle region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW557906; C78091; C79202; Unrip
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209478 representing NM_011499
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCATGAGGCAGACGCCGCTCACTTGCTCGGGCCACACGCGGCCCGTGGTGGATTTGGCCTTCAGCG
GCATCACGCCTTACGGCTACTTTCTGATCAGCGCTTGCAAAGATGGCAAGCCCATGCTCCGCCAGGGAGA
TACAGGAGACTGGATTGGAACATTTTTGGGTCATAAAGGTGCTGTTTGGGGTGCAACATTGAATAAGGAT
GCCACCAAAGCTGCGACAGCAGCTGCAGACTTCACAGCCAAAGTATGGGATGCGGTCTCAGGAGATGAAT
TGATGACCCTGGCTCATAAGCACATTGTCAAGACTGTGGATTTCACACAGGATAGCAATTACCTGCTAAC
TGGGGGACAGGATAAACTGCTGCGCATATATGACTTGAACAAACCTGAAGCAGAACCTAAGGAAATCAGT
GGCCACACTTCTGGTATTAAAAAGGCTCTGTGGTGCAGTGACGATAAACAGATCCTTTCAGCGGATGATA
AAACTGTTCGGCTCTGGGATCATGCCACAATGACAGAAGTGAAATCTCTGAATTTTAATATGTCTGTTAG
CAGCATGGAGTATATTCCTGAAGGAGAGATTTTGGTTATTACTTATGGACGATCTATTGCTTTTCATAGT
GCAGTAAGTCTGGAGCCAATTAAATCCTTTGAAGCTCCTGCGACCATCAATTCTGCGTCTCTTCATCCAG
AGAAGGAGTTTCTTGTTGCGGGTGGAGAAGACTTTAAACTGTACAAGTATGATTATAACAGTGGAGAAGA
GTTAGAATCCTACAAAGGTCACTTTGGTCCCATTCACTGTGTGAGATTCAGTCCTGATGGGGAACTCTAT
GCCAGCGGTTCTGAAGATGGGACATTGAGATTGTGGCAAACTGTGGTAGGAAAGACCTATGGCCTGTGGA
AATGCGTGCTTCCTGAGGAAGACAGCGGGGAACTGGCAAAGCCAAAGATCGGATTTCCAGAAACAGCAGA
GGAAGAGCTGGAAGAAATTGCTTCAGAGAATTCAGATTCCATCTATTCATCAACTCCTGAAGTTAAGGCC
TGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011499
Insert Size 1053 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011499.3, NP_035629.2
RefSeq Size 2644 bp
RefSeq ORF 1053 bp
Locus ID 20901
UniProt ID Q9Z1Z2
Gene Summary The SMN complex plays a catalyst role in the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus. STRAP plays a role in the cellular distribution of the SMN complex. Negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by significantly reducing the association of PDPK1 with 14-3-3 protein (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...