Sec61g (NM_001109971) Mouse Untagged Clone
CAT#: MC209377
Sec61g (untagged) - Mouse SEC61, gamma subunit (Sec61g), transcript variant 2, (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209377 representing NM_001109971
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATCAGGTAATGCAGTTTGTGGAGCCCAGCCGGCAGTTTGTAAAGGACTCAATTCGGCTGGTTAAAA GATGCACCAAACCCGACAGAAAAGAATTCCAGAAGATTGCCATGGCTACAGCTATAGGATTTGCTATCAT GGGATTCATTGGCTTCTTCGTGAAACTGATCCATATACCCATTAATAACATTATTGTGGGTGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001109971 |
Insert Size | 207 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001109971.1, NP_001103441.1 |
RefSeq Size | 779 bp |
RefSeq ORF | 207 bp |
Locus ID | 20335 |
UniProt ID | P60060 |
Gene Summary | Component of SEC61 channel-forming translocon complex that mediates transport of signal peptide-containing precursor polypeptides across endoplasmic reticulum (ER).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) includes an alternate segment in exon 1, compared to variant 1. This causes translation initiation at a downstream AUG and an isoform (2) with a shorter N-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG217065 | Sec61g (tGFP-tagged) - Mouse SEC61 gamma subunit (Sec61g) transcript variant 2, (10ug) |
CNY 2,090.00 |
|
MR217065 | Sec61g (Myc-DDK-tagged) - Mouse SEC61, gamma subunit (Sec61g), transcript variant 2 |
CNY 1,900.00 |
|
MR217065L3 | Lenti ORF clone of Sec61g (Myc-DDK-tagged) - Mouse SEC61, gamma subunit (Sec61g), transcript variant 2 |
CNY 3,800.00 |
|
MR217065L4 | Lenti ORF clone of Sec61g (mGFP-tagged) - Mouse SEC61, gamma subunit (Sec61g), transcript variant 2 |
CNY 3,800.00 |