S100a4 (NM_011311) Mouse Untagged Clone

CAT#: MC209346

S100a4 (untagged) - Mouse S100 calcium binding protein A4 (S100a4), (10ug)



  "NM_011311" in other vectors (4)

CN¥ 1,800.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 18A2; 42a; Capl; FSp1; metastasin; Mts1; PeL98; pk9a
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209346 representing NM_011311
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAAGACCCTTGGAGGAGGCCCTGGATGTAATTGTGTCCACCTTCCACAAATACTCAGGCAAAGAGG
GTGACAAGTTCAAGCTGAACAAGACAGAGCTCAAGGAGCTACTGACCAGGGAGCTGCCTAGCTTCCTGGG
GAAAAGGACAGATGAAGCTGCATTCCAGAAGGTGATGAGCAACTTGGACAGCAACAGGGACAATGAAGTT
GACTTCCAGGAGTACTGTGTCTTCCTGTCCTGCATTGCCATGATGTGCAATGAATTCTTTGAGGGCTGCC
CAGATAAGGAGCCCCGGAAGAAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_011311
Insert Size 306 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011311.2, NP_035441.1
RefSeq Size 513 bp
RefSeq ORF 306 bp
Locus ID 20198
UniProt ID P07091
Gene Summary Calcium-binding protein that plays a role in various cellular processes including motility, angiogenesis, cell differentiation, apoptosis, and autophagy (PubMed:20519440). Increases cell motility and invasiveness by interacting with non-muscle myosin heavy chain (NMMHC) IIA/MYH9 (PubMed:8051043). Mechanistically, promotes filament depolymerization and increases the amount of soluble myosin-IIA, resulting in the formation of stable protrusions facilitating chemotaxis (PubMed:8051043). Modulates also the pro-apoptotic function of TP53 by binding to its C-terminal transactivation domain within the nucleus and reducing its protein levels (By similarity). Within the extracellular space, stimulates cytokine production including granulocyte colony-stimulating factor and CCL24 from T-lymphocytes (PubMed:20103644). In addition, stimulates T-lymphocyte chemotaxis by acting as a chemoattractant complex with PGLYRP1 that promotes lymphocyte migration via CCR5 and CXCR3 receptors (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...