United States
Germany
Japan
United Kingdom
China
S100a4 (NM_011311) Mouse Untagged Clone
CAT＃: MC209346
S100a4 (untagged) - Mouse S100 calcium binding protein A4 (S100a4), (10ug)
CNY 1,800.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 18A2; 42a; Capl; FSp1; metastasin; Mts1; PeL98; pk9a |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209346 representing NM_011311
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCAAGACCCTTGGAGGAGGCCCTGGATGTAATTGTGTCCACCTTCCACAAATACTCAGGCAAAGAGG GTGACAAGTTCAAGCTGAACAAGACAGAGCTCAAGGAGCTACTGACCAGGGAGCTGCCTAGCTTCCTGGG GAAAAGGACAGATGAAGCTGCATTCCAGAAGGTGATGAGCAACTTGGACAGCAACAGGGACAATGAAGTT GACTTCCAGGAGTACTGTGTCTTCCTGTCCTGCATTGCCATGATGTGCAATGAATTCTTTGAGGGCTGCC CAGATAAGGAGCCCCGGAAGAAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_011311 |
| Insert Size | 306 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_011311.2, NP_035441.1 |
| RefSeq Size | 513 bp |
| RefSeq ORF | 306 bp |
| Locus ID | 20198 |
| UniProt ID | P07091 |
| Gene Summary | Calcium-binding protein that plays a role in various cellular processes including motility, angiogenesis, cell differentiation, apoptosis, and autophagy (PubMed:20519440). Increases cell motility and invasiveness by interacting with non-muscle myosin heavy chain (NMMHC) IIA/MYH9 (PubMed:8051043). Mechanistically, promotes filament depolymerization and increases the amount of soluble myosin-IIA, resulting in the formation of stable protrusions facilitating chemotaxis (PubMed:8051043). Modulates also the pro-apoptotic function of TP53 by binding to its C-terminal transactivation domain within the nucleus and reducing its protein levels (By similarity). Within the extracellular space, stimulates cytokine production including granulocyte colony-stimulating factor and CCL24 from T-lymphocytes (PubMed:20103644). In addition, stimulates T-lymphocyte chemotaxis by acting as a chemoattractant complex with PGLYRP1 that promotes lymphocyte migration via CCR5 and CXCR3 receptors (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG225750 | S100a4 (tGFP-tagged) - Mouse S100 calcium binding protein A4 (S100a4), (10ug) |
CNY 3,400.00 |
|
| MR225750 | S100a4 (Myc-DDK-tagged) - Mouse S100 calcium binding protein A4 (S100a4) |
CNY 1,800.00 |
|
| MR225750L3 | Lenti ORF clone of S100a4 (Myc-DDK-tagged) - Mouse S100 calcium binding protein A4 (S100a4) |
CNY 5,890.00 |
|
| MR225750L4 | Lenti ORF clone of S100a4 (mGFP-tagged) - Mouse S100 calcium binding protein A4 (S100a4) |
CNY 4,200.00 |
