Rpl5 (NM_016980) Mouse Untagged Clone

CAT#: MC209327

Rpl5 (untagged) - Mouse ribosomal protein L5 (Rpl5), (10ug)



  "NM_016980" in other vectors (4)

CN¥ 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
RPL5 Antibody - N-terminal region
    • 50 ug

CN¥ 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms U21RNA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209327 representing NM_016980
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGTTTGTGAAAGTTGTCAAGAATAAGGCCTACTTTAAAAGATACCAAGTGAGATTTCGAAGGCGGC
GAGAGGGTAAAACTGACTACTATGCTCGAAAACGATTGGTGATCCAGGACAAGAATAAGTACAACACACC
CAAATATAGGATGATAGTTCGTGTAACTAACAGAGATATCATCTGCCAGATTGCATATGCCCGTATAGAA
GGGGATATGATCGTCTGTGCAGCATATGCACATGAACTTCCAAAATATGGTGTGAAAGTTGGCCTGACAA
ATTATGCTGCAGCCTATTGCACTGGCCTGCTGCTGGCCCGCAGGCTTCTGAATAGGTTTGGCATGGACAA
GATCTATGAAGGCCAAGTGGAGGTGAATGGAGGTGAATACAATGTGGAAAGCATTGACGGTCAGCCTGGT
GCCTTCACTTGCTATCTGGATGCAGGTCTTGCCCGAACTACAACTGGCAATAAAGTTTTTGGGGCCCTGA
AGGGAGCTGTGGATGGAGGCTTGTCTATCCCTCATAGTACCAAACGATTCCCTGGTTATGACTCTGAAAG
CAAGGAGTTCAATGCAGAGGTACATCGGAAGCACATCATGGGTCAGAATGTGGCAGACTACATGCGCTAC
CTAATGGAGGAAGATGAAGATGCGTATAAGAAACAGTTCTCTCAGTACATCAAGAACAACGTAACTCCAG
ACATGATGGAGGAGATGTATAAGAAAGCTCATGCTGCTATCCGAGAGAATCCAGTCTATGAGAAGAAGCC
CAAGAGAGAAGTGAAGAAGAAGAGGTGGAATCGTCCCAAAATGTCTCTTGCCCAGAAGAAAGATCGGGTT
GCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAAAGGGCTGCTGAAAGCTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_016980
Insert Size 894 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016980.2, NP_058676.1
RefSeq Size 2036 bp
RefSeq ORF 894 bp
Locus ID 100503670
UniProt ID P47962
Gene Summary Component of the ribosome, a large ribonucleoprotein complex responsible for the synthesis of proteins in the cell. The small ribosomal subunit (SSU) binds messenger RNAs (mRNAs) and translates the encoded message by selecting cognate aminoacyl-transfer RNA (tRNA) molecules. The large subunit (LSU) contains the ribosomal catalytic site termed the peptidyl transferase center (PTC), which catalyzes the formation of peptide bonds, thereby polymerizing the amino acids delivered by tRNAs into a polypeptide chain. The nascent polypeptides leave the ribosome through a tunnel in the LSU and interact with protein factors that function in enzymatic processing, targeting, and the membrane insertion of nascent chains at the exit of the ribosomal tunnel. As part of the 5S RNP/5S ribonucleoprotein particle it is an essential component of the LSU, required for its formation and the maturation of rRNAs. It also couples ribosome biogenesis to p53/TP53 activation. As part of the 5S RNP it accumulates in the nucleoplasm and inhibits MDM2, when ribosome biogenesis is perturbed, mediating the stabilization and the activation of TP53. Interacts with RRP1B.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...