Ranbp1 (NM_011239) Mouse Untagged Clone
CAT#: MC209292
Ranbp1 (untagged) - Mouse RAN binding protein 1 (Ranbp1), (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Htf9a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209292 representing NM_011239
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCCGCCAAGGACAGTCACGAGGACCATGATACTTCCACAGAGAATGCAGATGAGTCCAACCACG ACCCCCAGTTCGAGCCAATAGTTTCTCTTCCCGAGCAAGAAATTAAAACGCTGGAGGAAGATGAAGAGGA ACTTTTTAAGATGCGTGCAAAGCTGTTCCGGTTTGCTTCAGAGAATGACCTCCCAGAATGGAAGGAGCGA GGCACTGGAGATGTCAAGCTTCTGAAGCACAAGGAGAAAGGGACCATCCGCCTTCTTATGAGGAGGGACA AAACCTTGAAGATATGCGCCAACCACTATATTACACCAATGATGGAGCTGAAGCCGAATGCTGGCAGTGA CCGAGCCTGGGTCTGGAATACCCACGCCGACTTTGCTGACGAGTGCCCCAAGCCTGAGCTGCTCGCCATC CGCTTCCTAAATGCTGAGAATGCACAAAAGTTCAAAACAAAGTTTGAAGAATGCAGGAAAGAAATTGAAG AGAGAGAAAAGAAAGGACCAGGCAAAAATGATAATGCCGAAAAGGTGGCCGAGAAGCTGGAAGCCCTTTC AGTGAGGGAGGCCAGAGAGGAGGCTGAAGAGAAGTCTGAGGAGAAACAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_011239 |
Insert Size | 612 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_011239.2, NP_035369.2 |
RefSeq Size | 852 bp |
RefSeq ORF | 612 bp |
Locus ID | 19385 |
UniProt ID | P34022 |
Gene Summary | Plays a role in RAN-dependent nucleocytoplasmic transport. Alleviates the TNPO1-dependent inhibition of RAN GTPase activity and mediates the dissociation of RAN from proteins involved in transport into the nucleus (PubMed:9428644). Induces a conformation change in the complex formed by XPO1 and RAN that triggers the release of the nuclear export signal of cargo proteins (By similarity). Promotes the disassembly of the complex formed by RAN and importin beta. Promotes dissociation of RAN from a complex with KPNA2 and CSE1L (PubMed:9428644). Required for normal mitotic spindle assembly and normal progress through mitosis via its effect on RAN (By similarity). Does not increase the RAN GTPase activity by itself, but increases GTP hydrolysis mediated by RANGAP1 (PubMed:9428644). Inhibits RCC1-dependent exchange of RAN-bound GDP by GTP (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202097 | Ranbp1 (tGFP-tagged) - Mouse RAN binding protein 1 (Ranbp1) |
CNY 2,850.00 |
|
MR202097 | Ranbp1 (Myc-DDK-tagged) - Mouse RAN binding protein 1 (Ranbp1) |
CNY 2,400.00 |
|
MR202097L3 | Lenti ORF clone of Ranbp1 (Myc-DDK-tagged) - Mouse RAN binding protein 1 (Ranbp1) |
CNY 4,750.00 |
|
MR202097L4 | Lenti ORF clone of Ranbp1 (mGFP-tagged) - Mouse RAN binding protein 1 (Ranbp1) |
CNY 4,750.00 |