Rab12 (NM_024448) Mouse Untagged Clone

CAT#: MC209270

Rab12 (untagged) - Mouse RAB12, member RAS oncogene family (Rab12), (10ug)



  "NM_024448" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2900054P15Rik; AW555448; C77700
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209270 representing NM_024448
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCCCAGCGCCGCGCTGCACCGGCGGCCCGCGGGCGGCAGCCTGGGCGCGGTCTCCCCGGCGCTGT
CGGGCGGCCAGGCCCGCCGGAGGAAGCAGCCCCCCAGGCCGGCCGACTTCAAGCTGCAGGTCATCATCAT
CGGCTCCCGCGGCGTGGGCAAGACCAGCCTGATGGAGCGCTTCACCGACGACACGTTCTGCGAGGCCTGC
AAGTCCACCGTGGGTGTTGACTTTAAAATCAAGACTGTAGAACTAAGAGGGAAGAAAATTAGATTACAGA
TCTGGGACACAGCAGGGCAGGAGCGATTTAACAGCATTACCTCAGCCTATTACAGAAGTGCCAAGGGGAT
CATACTCGTATATGACATCACCAAGAAGGAGACGTTCGATGACTTGCCAAAGTGGATGAAGATGATTGAC
AAGTATGCTTCAGAAGACGCCGAGCTCCTCCTGGTTGGAAATAAGCTGGACTGTGAGACAGACAGAGAAA
TCTCAAGGCAGCAAGGAGAAAAGTTTGCACAGCAGATAACCGGGATGCGCTTCTGCGAAGCCAGTGCCAA
GGACAATTTCAATGTGGACGAGATCTTTCTGAAACTTGTTGATGATATTCTGAAAAAGATGCCTCTTGAT
GTTTTGAGAAACGAGTTATCCAATAGCATCCTTTCTCTACAACCAGAGCCTGAGATCCCACCAGAGCTGC
CTCCTCCCAGACCACACGTCCGATGCTGTTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_024448
Insert Size 732 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_024448.2, NP_077768.2
RefSeq Size 2010 bp
RefSeq ORF 732 bp
Locus ID 19328
UniProt ID P35283
Gene Summary The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different set of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion (By similarity). That Rab may play a role in protein transport from recycling endosomes to lysosomes regulating, for instance, the degradation of the transferrin receptor. Involved in autophagy.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...