Prnp (NM_011170) Mouse Untagged Clone
CAT#: MC209234
Prnp (untagged) - Mouse prion protein (Prnp), (10ug)
CNY 3,600.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AA960666; AI325101; CD230; Prn-i; Prn-p; PrP; prP27-30; prP33-35C; PrP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209234 representing NM_011170
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGAACCTTGGCTACTGGCTGCTGGCCCTCTTTGTGACTATGTGGACTGATGTCGGCCTCTGCAAAA AGCGGCCAAAGCCTGGAGGGTGGAACACCGGTGGAAGCCGGTATCCCGGGCAGGGAAGCCCTGGAGGCAA CCGTTACCCACCTCAGGGTGGCACCTGGGGGCAGCCCCACGGTGGTGGCTGGGGACAACCCCATGGGGGC AGCTGGGGACAACCTCATGGTGGTAGTTGGGGTCAGCCCCATGGCGGTGGATGGGGCCAAGGAGGGGGTA CCCATAATCAGTGGAACAAGCCCAGCAAACCAAAAACCAACCTCAAGCATGTGGCAGGGGCTGCGGCAGC TGGGGCAGTAGTGGGGGGCCTTGGTGGCTACATGCTGGGGAGCGCCATGAGCAGGCCCATGATCCATTTT GGCAACGACTGGGAGGACCGCTACTACCGTGAAAACATGTACCGCTACCCTAACCAAGTGTACTACAGGC CAGTGGATCAGTACAGCAACCAGAACAACTTCGTGCACGACTGCGTCAATATCACCATCAAGCAGCACAC GGTCACCACCACCACCAAGGGGGAGAACTTCACCGAGACCGATGTGAAGATGATGGAGCGCGTGGTGGAG CAGATGTGCGTCACCCAGTACCAGAAGGAGTCCCAGGCCTATTACGACGGGAGAAGATCCAGCAGCACCG TGCTTTTCTCCTCCCCTCCTGTCATCCTCCTCATCTCCTTCCTCATCTTCCTGATCGTGGGATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_011170 |
Insert Size | 765 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC006703, AAH06703 |
RefSeq Size | 2191 bp |
RefSeq ORF | 765 bp |
Locus ID | 19122 |
UniProt ID | P04925 |
Gene Summary | Its primary physiological function is unclear. May play a role in neuronal development and synaptic plasticity. May be required for neuronal myelin sheath maintenance. May promote myelin homeostasis through acting as an agonist for ADGRG6 receptor. May play a role in iron uptake and iron homeostasis. Soluble oligomers are toxic to cultured neuroblastoma cells and induce apoptosis (in vitro) (By similarity). Association with GPC1 (via its heparan sulfate chains) targets PRNP to lipid rafts. Also provides Cu(2+) or ZN(2+) for the ascorbate-mediated GPC1 deaminase degradation of its heparan sulfate side chains (PubMed:12732622, PubMed:16492732, PubMed:19242475, PubMed:19568430).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shorter transcript. Variants 1 and 2 encode the same protein. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Identification of a compound which disrupts binding of amyloid-beta to the prion protein using a novel fluorescence-based assay
,Risse, E;Nicoll, AJ;Taylor, WA;Wright, D;Badoni, M;Yang, X;Farrow, MA;Collinge, J;,
J. Biol. Chem.
,PubMed ID 25995455
[PRNP]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227504 | Prnp (tGFP-tagged) - Mouse prion protein (Prnp), (10ug) |
CNY 5,200.00 |
|
MR227504 | Prnp (Myc-DDK-tagged) - Mouse prion protein (Prnp) |
CNY 3,600.00 |
|
MR227504L3 | Lenti ORF clone of Prnp (Myc-DDK-tagged) - Mouse prion protein (Prnp) |
CNY 4,470.00 |
|
MR227504L4 | Lenti ORF clone of Prnp (mGFP-tagged) - Mouse prion protein (Prnp) |
CNY 4,470.00 |