Oaz1 (NM_008753) Mouse Untagged Clone
CAT#: MC209067
Oaz1 (untagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Antiz; Antizyme; AZ; AZ-; AZ-1; AZ1; Oaz; ODC-Az |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209067 representing NM_008753
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGTGAAATCCTCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAAC GCAGCGCCACGCTTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAG CGAGAGTTCTAGGGTTGCCCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCCATGGTG AAATCCTCCCTGCAGCGGATCCTCAACAGCCACTGCTTCGCCAGAGAGAAGGAAGGGGACAAACGCAGCG CCACGCTTCACGCCAGCCGCACCATGCCGCTTCTTAGTCAGCACAGCCGCGGCGGCTGCAGCAGCGAGAG TTCTAGGGTTGCCCTTAATTGCTGTAGTAACCTGGGTCCGGGGCCTCGGTGGTGCTCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_008753 |
Insert Size | 408 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_008753.4, NP_032779.2 |
RefSeq Size | 1092 bp |
RefSeq ORF | 685 bp |
Locus ID | 18245 |
UniProt ID | P54369 |
Gene Summary | The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 1, the first member of the antizyme family, that has broad tissue distribution, and negatively regulates intracellular polyamine levels by binding to and targeting ODC for degradation, as well as inhibiting polyamine uptake. Antizyme 1 mRNA contains two potential in-frame AUGs; and studies in rat suggest that alternative use of the two translation initiation sites results in N-terminally distinct protein isoforms with different subcellular localization. Alternatively spliced transcript variants have also been noted for this gene. [provided by RefSeq, Dec 2014] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221840 | Oaz1 (tGFP-tagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1), (10ug) |
CNY 2,090.00 |
|
MR221840 | Oaz1 (Myc-DDK-tagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1) |
CNY 1,900.00 |
|
MR221840L3 | Lenti ORF clone of Oaz1 (Myc-DDK-tagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1) |
CNY 3,800.00 |
|
MR221840L4 | Lenti ORF clone of Oaz1 (mGFP-tagged) - Mouse ornithine decarboxylase antizyme 1 (Oaz1) |
CNY 3,800.00 |